ID: 944655500

View in Genome Browser
Species Human (GRCh38)
Location 2:201873183-201873205
Sequence TCCACGTAGAATAAAATATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944655497_944655500 29 Left 944655497 2:201873131-201873153 CCAAAAGTTGTTTGAATTCTTCA 0: 1
1: 0
2: 2
3: 31
4: 340
Right 944655500 2:201873183-201873205 TCCACGTAGAATAAAATATCAGG 0: 1
1: 0
2: 0
3: 10
4: 137
944655498_944655500 -10 Left 944655498 2:201873170-201873192 CCTTTAAAAAGCCTCCACGTAGA 0: 1
1: 0
2: 2
3: 4
4: 80
Right 944655500 2:201873183-201873205 TCCACGTAGAATAAAATATCAGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944655500 Original CRISPR TCCACGTAGAATAAAATATC AGG Intronic
907171549 1:52470797-52470819 TCCAGGTAAGATAAAATTTCTGG - Intronic
913065715 1:115252249-115252271 TCCACGTGGAAGAGAATATTTGG + Intergenic
915996150 1:160566055-160566077 TCCACGTAGTCTAAGATATTAGG + Intronic
917352381 1:174091479-174091501 TCCACAGAGAAAAAAATATAAGG - Intergenic
917397654 1:174611792-174611814 TTCAAGGAGAATAAAATACCTGG - Intronic
917835286 1:178937074-178937096 TCCACTTAATAGAAAATATCTGG - Intergenic
918877455 1:190066998-190067020 TGCAAGTAGAGTAAAATCTCAGG - Intergenic
920667722 1:207977072-207977094 TTCACGTATAGTAAAATATTTGG + Intergenic
920874724 1:209823612-209823634 TCCACGTACAATAAATTCTGTGG + Intergenic
923376642 1:233370440-233370462 TCCACCAAGCACAAAATATCAGG - Intronic
923831388 1:237561592-237561614 TCCACTTAGGATAAAATATAGGG + Intronic
924146345 1:241079413-241079435 TCCATCGAGAATAAAATGTCAGG + Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1064815054 10:19251616-19251638 TCCAAGTAGGGTAAAATATCAGG + Intronic
1065194937 10:23255185-23255207 AACACGGAGAATAAAATATGAGG + Intergenic
1065607468 10:27433395-27433417 TCCACCTAGAATTATATATCTGG + Intergenic
1069603783 10:69726942-69726964 TCCAAGGAAAATGAAATATCTGG - Intergenic
1070059205 10:72966304-72966326 TCACCCTAGAATAATATATCTGG - Intergenic
1072369496 10:94750261-94750283 TACGCATAAAATAAAATATCAGG - Intronic
1073835961 10:107443073-107443095 TATACTTAGAATAAAATATAGGG + Intergenic
1075794727 10:125111707-125111729 TCCATGTAGAGTAAAATAAATGG - Intronic
1079389698 11:20010959-20010981 TCCACTTAGTTTAAAATGTCAGG - Intronic
1079773524 11:24495207-24495229 TCCAAGTAAAATAAAAACTCTGG - Intergenic
1079848879 11:25504164-25504186 TCCACAAAAAATAAAATACCTGG - Intergenic
1087815639 11:102655307-102655329 TCCCCGTAGAAGGAAATAGCAGG + Intergenic
1088399116 11:109403560-109403582 TCCAAGGGGAATAAAATACCTGG + Intergenic
1089140736 11:116281903-116281925 TCCACATAGAAGGAAACATCAGG + Intergenic
1095236286 12:39800092-39800114 TCTAGGTACAATAAAAAATCAGG + Intronic
1095485531 12:42680400-42680422 TTCAGTAAGAATAAAATATCAGG + Intergenic
1097752225 12:63368154-63368176 TACAAGGAGAATAAAATACCTGG - Intergenic
1098465356 12:70780733-70780755 ACCACACAGAATAAAACATCAGG - Intronic
1099059688 12:77891846-77891868 TCCAGGTAGGATAAAATAAATGG - Intronic
1101220127 12:102630221-102630243 TACACGGAGAATAGAATATGAGG - Intergenic
1101546300 12:105716647-105716669 TCCAAGTAGAAAAAGAAATCAGG + Intergenic
1108063850 13:46557540-46557562 TCTACGAAAAATAAAATATTAGG + Intronic
1109903515 13:68806904-68806926 GCCACGGAGAATAATATATAGGG - Intergenic
1111506458 13:89196031-89196053 TACAAAGAGAATAAAATATCTGG + Intergenic
1113022523 13:105904130-105904152 TACTCGTAGAATAAAATGTTAGG + Intergenic
1114207241 14:20583746-20583768 TCCAGTTAGAATAAATAATCAGG + Exonic
1114897220 14:27006312-27006334 TCCACCAGGAACAAAATATCAGG + Intergenic
1115312396 14:31992674-31992696 TCCACCTTGCATAAAAGATCTGG - Intergenic
1116451839 14:45075554-45075576 TACACTTAGAAGAAAATATAAGG - Intergenic
1119905827 14:78301129-78301151 TCCACATTAAATAAAATTTCAGG - Intronic
1121758876 14:96426670-96426692 TTCACCTAGAATAGTATATCTGG - Intronic
1124062801 15:26310174-26310196 TTCACCTAGAATAAAATGGCTGG + Intergenic
1124561642 15:30779651-30779673 TTCAAAGAGAATAAAATATCTGG + Intergenic
1126115914 15:45207423-45207445 TACACCTATGATAAAATATCAGG + Intergenic
1127336544 15:57991347-57991369 TACAACTAGAATAAAATATTTGG + Intronic
1130318260 15:82815381-82815403 TCCACGTTGGAGCAAATATCAGG + Intronic
1131735598 15:95327993-95328015 TCCTCCTAGAAAAAAAAATCTGG - Intergenic
1132429584 15:101749638-101749660 TCCACGTAGAGTAGAATTACTGG + Intergenic
1133802645 16:9096607-9096629 TCCAGGTAGAATATGATTTCTGG - Intronic
1139500328 16:67358516-67358538 TCCACAAAAAATAAAATAGCTGG - Intronic
1143441436 17:6977625-6977647 TTGATGTAAAATAAAATATCTGG + Intronic
1146152934 17:30492093-30492115 TCCACTAATAATAAAGTATCAGG - Intronic
1147365634 17:39957388-39957410 TCCCTGATGAATAAAATATCTGG - Intergenic
1150041886 17:61871480-61871502 TGCATGTATAATAAAATGTCAGG - Intronic
1150657418 17:67049080-67049102 TCCAGGTAGAATAAACTCTAAGG + Intronic
1153378507 18:4409317-4409339 TCCAAGTAGATTAAAATATTTGG + Intronic
1154460064 18:14574327-14574349 TTCAAAGAGAATAAAATATCTGG - Intergenic
1155372929 18:25122473-25122495 TCCAGGTAGAATATAATTTTAGG - Intronic
1164947403 19:32308069-32308091 TCCACATAGATAAAGATATCTGG - Intergenic
1165373381 19:35424532-35424554 TCCAAGCAGAAGAAAAGATCTGG + Intergenic
1167790155 19:51671366-51671388 TCCAATTAGAAAAAAAAATCAGG - Intergenic
1168192112 19:54746491-54746513 AACACGTAGAAGAAAATATTGGG - Intronic
1168194390 19:54763047-54763069 AACACGTAGAAGAAAATATTGGG - Intronic
1168196442 19:54777769-54777791 AACACGTAGAACAAAATATTGGG - Intronic
1168204801 19:54842025-54842047 AACACGTAGAAGAAAATATTGGG - Intronic
930950626 2:57139812-57139834 TACACCTTCAATAAAATATCCGG - Intergenic
931555013 2:63493528-63493550 ACCCCATAGAATAAAATATCTGG - Intronic
932551135 2:72770720-72770742 TCCTCTTAGCATTAAATATCAGG - Intronic
943833901 2:192494515-192494537 TTCATATAGATTAAAATATCTGG - Intergenic
943839644 2:192562524-192562546 TCCATGTAGAATTAAAAATAAGG - Intergenic
944035929 2:195294495-195294517 TACAAGGAGAATAAAATACCTGG + Intergenic
944655500 2:201873183-201873205 TCCACGTAGAATAAAATATCAGG + Intronic
1170440116 20:16370585-16370607 TCAACGTAAACTAAAATATGAGG - Exonic
1174378051 20:50139280-50139302 TCCACGTGGAACAAAAGCTCAGG + Intronic
1175665559 20:60855950-60855972 TAAACATAGAATAAAATATTTGG + Intergenic
1176814048 21:13578505-13578527 TTCAAAGAGAATAAAATATCTGG + Intergenic
1179316837 21:40251429-40251451 TCTACGTAGAAGGAAACATCGGG - Intronic
1181839559 22:25644952-25644974 TCCACAGAAAATAAAATAACTGG - Intronic
1182919702 22:34067974-34067996 TAAACATAGAATATAATATCAGG - Intergenic
1183168737 22:36167965-36167987 TCAAAGGAAAATAAAATATCAGG - Intergenic
949640645 3:6032179-6032201 TACAAAGAGAATAAAATATCTGG - Intergenic
951402212 3:22247372-22247394 TTCACATAGTATAAAAAATCTGG - Intronic
956170791 3:66431912-66431934 TACACGTAGAAAAAAAGATAGGG + Intronic
957097475 3:75789988-75790010 TACAAATAAAATAAAATATCTGG + Intergenic
957570374 3:81939889-81939911 TCAACATAGTATAACATATCAGG - Intergenic
957788020 3:84905823-84905845 TCCAGGAAGAATAAAGTATGTGG - Intergenic
962360057 3:134732825-134732847 TATAAGTAGAATAAAATATAAGG - Intronic
964651214 3:159013839-159013861 TGCAAGTAGGATAAAATCTCAGG - Intronic
967402347 3:189077796-189077818 TCCAACTAAAAGAAAATATCTGG - Intronic
973071976 4:45872034-45872056 TCCACATAGAATTATACATCCGG + Intergenic
974200827 4:58637916-58637938 TGCAGATAGAATAAAATAACAGG - Intergenic
974284457 4:59846201-59846223 TTCAAAGAGAATAAAATATCTGG + Intergenic
976856874 4:89614361-89614383 TCTACTTAGCATAAACTATCAGG + Intergenic
977036187 4:91956621-91956643 TCCAGTTAGAAAAAAATAGCAGG + Intergenic
979129761 4:117028253-117028275 TCCTGGTAGAATAAATTACCAGG - Intergenic
981279428 4:142940259-142940281 AACACATATAATAAAATATCTGG + Intergenic
981772855 4:148330128-148330150 TGCAAGTAGAAAAAAATAACAGG + Intronic
982126151 4:152185582-152185604 TCCATGCAGAATGAAAGATCAGG - Intergenic
986777019 5:11025221-11025243 TCCACGGAGAAGAAAACCTCGGG + Intronic
988247102 5:28700675-28700697 TCCACTTAGAATAGAATAATGGG + Intergenic
989250098 5:39303626-39303648 TCCACTTAGAGTAAAACAGCAGG + Intronic
989832526 5:45938263-45938285 TTCACCAAGAATAAAATACCTGG - Intergenic
993550431 5:89266975-89266997 TCCTTTTAGAATTAAATATCAGG + Intergenic
994904395 5:105818216-105818238 TCCACAGAGAAAAAAATATCTGG - Intergenic
995420520 5:111961855-111961877 TCCAGGTAGAATAAAATAAATGG - Intronic
996898367 5:128513558-128513580 TCAAAAGAGAATAAAATATCAGG + Intronic
997109159 5:131055665-131055687 TCAACCTAGAATACTATATCTGG + Intergenic
998011452 5:138698713-138698735 TCCCTGTAGAATAAAAGATCCGG - Intronic
1001779052 5:174351751-174351773 TCCAGGAAGAATAAAATAATTGG + Intergenic
1004470519 6:15924843-15924865 TGCACCTAGAATGAAATAACAGG + Intergenic
1004819548 6:19352381-19352403 TTCACATAGAATAAGAGATCCGG - Intergenic
1005117102 6:22351107-22351129 TCCACTCAGAATAAAATATTGGG + Intergenic
1007868771 6:45007918-45007940 TATAAATAGAATAAAATATCTGG + Intronic
1008019520 6:46560243-46560265 TACACTGAGAATAAAATATAGGG + Intronic
1015987782 6:138901941-138901963 TCCACCTAGAATACAAACTCAGG + Intronic
1020539359 7:9440782-9440804 TTCAAAGAGAATAAAATATCTGG + Intergenic
1028313536 7:89370024-89370046 TCAACGTAGAATTAAATAAAAGG + Intergenic
1029834399 7:103294254-103294276 AACACGTAGGATAAAATATTTGG - Intergenic
1031551041 7:123111941-123111963 ACCACATAGAGGAAAATATCAGG - Intergenic
1031683056 7:124698265-124698287 TCCATTTAAAATATAATATCAGG - Intergenic
1033091776 7:138392873-138392895 TCCACGTCAAATAAGATAACAGG - Intergenic
1035570371 8:668892-668914 TCCACACAGAATGACATATCTGG + Intronic
1036037839 8:5039423-5039445 TCCACGTGGAAGGAGATATCTGG + Intergenic
1038652550 8:29418924-29418946 TCCACTTAGAATGGATTATCTGG - Intergenic
1039127984 8:34225780-34225802 TCTACATAGAATAAAATATAAGG + Intergenic
1039654297 8:39382938-39382960 TACTCTTAGAATAAAATATAGGG - Intergenic
1041758233 8:61337105-61337127 TCCACGTTGACTACAAGATCAGG + Intronic
1042898594 8:73697303-73697325 TTCACCTAGAATAGTATATCTGG + Intronic
1048094653 8:131278627-131278649 TACAAGTAGGATAAAATGTCAGG - Intergenic
1049965810 9:778261-778283 TCCACCAAGAATAAACTATTTGG + Intergenic
1052092761 9:24349372-24349394 TTCACTTAGAATTAACTATCTGG - Intergenic
1186257291 X:7736279-7736301 TGCATGTAGAGTAAAATCTCAGG + Intergenic
1188594953 X:31888537-31888559 TGCACGTAGTATGAAATATTTGG + Intronic
1188638041 X:32460359-32460381 TCCAGGTAGAAAAAAAAAACAGG - Intronic
1189647737 X:43152328-43152350 TCTTCACAGAATAAAATATCTGG + Intergenic
1190152896 X:47963111-47963133 AACACGTAGAACAAAATATTAGG - Intronic
1191130984 X:57010545-57010567 TCACCCTAGAATAATATATCTGG - Intergenic
1192073366 X:67964140-67964162 TCTCCCTAGAATAGAATATCTGG + Intergenic
1193887168 X:86996698-86996720 TCAGCCTAGAATAATATATCAGG - Intergenic
1194389335 X:93296563-93296585 TTAACCTAGAATAATATATCTGG + Intergenic
1195234471 X:102883095-102883117 TTCACATGGAATAAAATATTGGG + Intergenic
1196590884 X:117484344-117484366 TCGCAGTACAATAAAATATCAGG + Intergenic
1197027601 X:121773637-121773659 TCCACTTAGAATAAGGTCTCTGG + Intergenic
1197060734 X:122177381-122177403 TTCTAGTAGAATATAATATCAGG - Intergenic
1198595266 X:138229227-138229249 TCCACTTAGAAAAAAATACAGGG + Intergenic