ID: 944655509

View in Genome Browser
Species Human (GRCh38)
Location 2:201873249-201873271
Sequence CCCTCCCAGTGAAAGATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944655509_944655512 -8 Left 944655509 2:201873249-201873271 CCAGAGATCTTTCACTGGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 106
Right 944655512 2:201873264-201873286 TGGGAGGGACAGGTATCTCCAGG 0: 1
1: 0
2: 1
3: 14
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944655509 Original CRISPR CCCTCCCAGTGAAAGATCTC TGG (reversed) Intronic
900959997 1:5912857-5912879 CCCTCCCAGTGAGGGAGCCCAGG - Intronic
902987484 1:20163884-20163906 CCCTCCCAGTGGAAGAACAGGGG + Intronic
903351435 1:22718997-22719019 CCCTCCCATTGCATTATCTCAGG - Intronic
907952388 1:59196228-59196250 CCGTGCAAGTGAAATATCTCCGG + Intergenic
909047782 1:70730787-70730809 CCCTCAGTGAGAAAGATCTCTGG + Intergenic
911230917 1:95360710-95360732 CCCTCCCAGTGATGGAACCCAGG - Intergenic
915121193 1:153630347-153630369 CCCTCACATTGTAAAATCTCAGG + Intronic
917299289 1:173556128-173556150 CCCTCCCAGAAACAGATCTGGGG + Intronic
919338321 1:196268218-196268240 CCCTCCAAGGTAAAGAACTCTGG + Intronic
1064579133 10:16775639-16775661 CCCTCCCATAGCATGATCTCAGG + Intronic
1065966253 10:30773048-30773070 CCCTTCCAGTGAAAGAGCCCTGG + Intergenic
1074876816 10:117620139-117620161 CATCCCCAGTGACAGATCTCTGG - Intergenic
1074893765 10:117757197-117757219 CCCTCCTGGAGAAATATCTCTGG + Intergenic
1076249287 10:128972580-128972602 CCCTCCCAGTGACAGTGCTGAGG - Intergenic
1076427073 10:130374473-130374495 TCCTCCCAGTCAAGGGTCTCAGG - Intergenic
1076538030 10:131195547-131195569 CCCTCTCATAGAAAGCTCTCGGG - Intronic
1076922020 10:133459215-133459237 CCCTCACAGTGAAAGGCATCAGG - Intergenic
1078154819 11:8790280-8790302 TCCTCCCAGTGAAACATCTAGGG + Intronic
1079442564 11:20529859-20529881 CCCTCACATTGTAAGATCTTAGG - Intergenic
1079655254 11:22978767-22978789 GGCTCCCAGTGAAGGCTCTCAGG - Intergenic
1080315111 11:30938811-30938833 CCTTCCCAGTGAATTATCTGTGG + Intronic
1083180828 11:60984002-60984024 CCTTCCCAGTGAATCATATCAGG + Intronic
1084661615 11:70549667-70549689 CCATCCCAGGGACAGAGCTCTGG - Intronic
1085244955 11:75093518-75093540 CTCCCTCAGTTAAAGATCTCCGG - Intergenic
1086871805 11:92046693-92046715 CCCTCTCATTGAAAGATGACTGG + Intergenic
1089665656 11:120016853-120016875 CTCTCCCAATGTAAGATCCCAGG + Intergenic
1090490003 11:127151914-127151936 ACTTCCTAGTGACAGATCTCTGG + Intergenic
1092483707 12:8883228-8883250 CCATCAGAGTGTAAGATCTCTGG + Intronic
1099234509 12:80067920-80067942 CCCTCCCAGTGAAAGTTTGCAGG - Intergenic
1099659752 12:85541951-85541973 CCCTCCAAGTTAAATTTCTCTGG + Intergenic
1102315772 12:111886143-111886165 CCTTCCCAGAGAAACATCTCTGG + Intronic
1107814739 13:44234234-44234256 CCTTCTCAGTGAGGGATCTCAGG + Intergenic
1108809109 13:54199209-54199231 CCATTTCAGTGAAAGTTCTCAGG - Intergenic
1111886136 13:94023723-94023745 CTCTCCCACTGAAGGATATCTGG - Intronic
1114238770 14:20846885-20846907 CCCTCTCAGTGACAGGTCACAGG - Intergenic
1123072390 14:105648105-105648127 CCCACCCAGTGCAAGATGACGGG - Intergenic
1127902383 15:63350387-63350409 CACTCCCAGTGGAGGATTTCTGG - Intronic
1129995924 15:80006188-80006210 GCCTGCCTGTGAAAAATCTCAGG - Intergenic
1131692762 15:94844916-94844938 GACGCCCAGTGAAAGTTCTCCGG - Intergenic
1132785454 16:1654766-1654788 CACGCCCAGTGAAAGATGCCAGG - Intronic
1133878141 16:9754444-9754466 CCTTCCCAGTGAAAAATTTGGGG + Intronic
1138210070 16:55156030-55156052 CCCGCCCAGTGACAGAGCCCAGG - Intergenic
1143556680 17:7666351-7666373 CCCTCCCACTCAAAGAGCCCAGG - Intronic
1144192023 17:12855166-12855188 CCCTGCCAGAGGAAGATCTCTGG + Intronic
1144994593 17:19258765-19258787 CCCACACAGGGAAAGGTCTCTGG + Intronic
1145787279 17:27602457-27602479 CCCTCCCTGTGACATATCTTCGG - Intronic
1146059506 17:29596989-29597011 CCCTCCCCTTGAATGAGCTCAGG + Intronic
1146659802 17:34658157-34658179 CCCTCCCACTGAGAGGTCTCTGG + Intergenic
1147904815 17:43816061-43816083 CCCTCACAGTCACAGGTCTCTGG + Exonic
1148723455 17:49771733-49771755 CCCTCCCAGAGGAAAGTCTCTGG + Intronic
1149508065 17:57212422-57212444 CCCCCCCAGTGAAGGATGACTGG + Intergenic
1151713838 17:75821504-75821526 CCATCCCAGAGGAAGACCTCAGG - Intronic
1155686998 18:28565764-28565786 TCCTCCCAATGAAACATCCCAGG - Intergenic
1156229454 18:35139632-35139654 CCCTCCCAATGAGGGAGCTCAGG - Intronic
1160549326 18:79683251-79683273 CTCTCCCAGATAAAGATCTCAGG - Intronic
1163014089 19:14443276-14443298 CCCTCCCAGGGAAACCCCTCGGG - Intronic
1166222265 19:41373320-41373342 CACTTCCAGTGAGAGCTCTCTGG - Intronic
1166344391 19:42156329-42156351 CCCACCCAGTGACAGAGCACAGG + Intronic
1167235160 19:48309855-48309877 TCCTTCCTGTGCAAGATCTCAGG - Intronic
1167656744 19:50769752-50769774 ACATCCCAGTGAGAGATGTCAGG - Intergenic
1167972623 19:53197923-53197945 CCCTTCCTGAGAAAGATTTCGGG - Intergenic
944655509 2:201873249-201873271 CCCTCCCAGTGAAAGATCTCTGG - Intronic
947819189 2:233058916-233058938 CACTCCCAGTCAAGGACCTCTGG - Intergenic
1173131042 20:40393879-40393901 TCCTCCCAGCGAAAGGTCTTAGG + Intergenic
1173227139 20:41168534-41168556 CTCTGCCAGTGAAATACCTCGGG - Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1174926198 20:54762814-54762836 CCCTCTCAGTGCATGCTCTCAGG + Intergenic
1175154470 20:56960560-56960582 CCCTTCCAATGACAAATCTCTGG + Intergenic
1175860150 20:62145797-62145819 ACCTCCCAGTAAAAGATCCCTGG - Intronic
1179028045 21:37696366-37696388 CCCTCCCAGTGCATTATATCAGG - Intronic
1182243917 22:28939993-28940015 TCCTCACAGTGAAAGACCTGAGG - Intronic
1183014410 22:34974043-34974065 CCCTCCCTGTGAAATAGCTTGGG - Intergenic
949706174 3:6820021-6820043 GCCTCCACGTCAAAGATCTCAGG + Intronic
950265386 3:11569387-11569409 CCCACCCAGTGAAAGAGATGAGG + Intronic
953573768 3:44096166-44096188 CCATGCCAGTGAAAAATCTGTGG - Intergenic
956011219 3:64833653-64833675 GCCTCAGAGTGAAAGATCTTAGG + Intergenic
965158669 3:165100434-165100456 GCTTCCCAGTGAATTATCTCTGG - Intergenic
965895466 3:173570479-173570501 CTCACCCAGTTAAAGATTTCAGG - Intronic
967945589 3:194801489-194801511 ACCTCCCAGAGCAAGCTCTCTGG - Intergenic
972183002 4:36492400-36492422 CCCTCCCAGTAGAAGATCCTAGG - Intergenic
972216607 4:36905104-36905126 CCCTCGCAGAGAAAAATCTTAGG + Intergenic
977028441 4:91851650-91851672 GGCTGCCAGTGAAAGAACTCTGG - Intergenic
977627711 4:99205533-99205555 CAGTCCCAGTGAAAGCTCTTGGG + Intronic
978723693 4:111945541-111945563 CCCTTCCAGTTAAAGAAATCAGG - Intergenic
979723400 4:123930867-123930889 CCCTCTCACTGCAAGATGTCTGG - Intergenic
983461300 4:168028282-168028304 CCCTACTAGAGAAGGATCTCAGG + Intergenic
989704259 5:44309295-44309317 CCCTCCCAGAGACAGATCAAGGG - Intronic
991577065 5:68115705-68115727 TCCTCCCAGTGAACCATATCAGG + Intergenic
993241368 5:85391331-85391353 CTCTCCCATTGAAAGATTTCTGG + Intergenic
993852162 5:93023788-93023810 TCTTCCCAGTGGAAGATCCCAGG - Intergenic
994116561 5:96067803-96067825 CCCTCCCAGTGCAAAATGGCAGG - Intergenic
994796705 5:104310337-104310359 CCCTTCCAGTGAAATAACTCGGG + Intergenic
995406796 5:111806896-111806918 TGCTCCCAGAGAATGATCTCTGG - Intronic
996798519 5:127377192-127377214 CCATCACAAAGAAAGATCTCAGG - Intronic
999448082 5:151657359-151657381 CCCTCCCTGTAAATGACCTCTGG - Intergenic
1006383105 6:33712216-33712238 GCCTCCCAGAGAAAAATGTCTGG - Intergenic
1007078373 6:39082195-39082217 CCCTCCCATTTAGAGATCTGAGG - Intronic
1010327991 6:74587567-74587589 CCCTCCCAGTCCACTATCTCTGG - Intergenic
1015227490 6:130873985-130874007 CCTTCCCAGTGAGAGATCACTGG + Intronic
1017433082 6:154390564-154390586 CCCACTCAGTGAAACTTCTCTGG - Exonic
1018823932 6:167395285-167395307 CCCACCCCATGGAAGATCTCAGG + Intergenic
1031950289 7:127884905-127884927 CCCTACCAGTGAAAGTACTAAGG - Intronic
1032444818 7:131973155-131973177 TCCTTCCAGTGATACATCTCAGG - Intergenic
1039047155 8:33460818-33460840 ACCTCCCAGTAAAAAACCTCTGG - Intronic
1039127700 8:34221750-34221772 CTCTCCCAGTGAAAGCTCCAGGG + Intergenic
1044789221 8:95829635-95829657 CCCTCCCATACAAAGATCTGGGG + Intergenic
1045408114 8:101888033-101888055 CAGTCCCAGTGAAAGTTCTGAGG + Intronic
1045648604 8:104322921-104322943 CACTCCCTGGGAAATATCTCGGG - Intergenic
1048969488 8:139636921-139636943 CCCTCTCACTGAATGAGCTCTGG - Intronic
1049698939 8:143998244-143998266 CCCACCCAGCGAAGGATCACTGG + Intronic
1057037987 9:91825462-91825484 TCTTCCAAGTGCAAGATCTCAGG - Intronic
1058798450 9:108521017-108521039 CCCTCCCAGGGTAACATCTTTGG - Intergenic
1058815635 9:108680485-108680507 CCCTTCCCGTGAAAGAACTGAGG + Intergenic
1060822597 9:126670057-126670079 CCCTCCCAGTGCCAGGTTTCTGG - Intronic
1060917440 9:127399399-127399421 CCCCACCACTGAAAGATCTGTGG - Intronic
1185788423 X:2909916-2909938 CCCGGCCAGTGGAAGATCCCGGG + Exonic
1198064790 X:133085355-133085377 GCCTCCTAGTGAAGGACCTCAGG - Intronic
1198674296 X:139115615-139115637 TCCTTCAAGTGAAAGATGTCTGG - Intronic