ID: 944655738

View in Genome Browser
Species Human (GRCh38)
Location 2:201875007-201875029
Sequence TTTGATTTCCTAGCACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944655738_944655744 23 Left 944655738 2:201875007-201875029 CCAGGCTGTGCTAGGAAATCAAA 0: 1
1: 0
2: 0
3: 8
4: 189
Right 944655744 2:201875053-201875075 ACAACCAGATTTTAGTAGTATGG 0: 1
1: 0
2: 1
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944655738 Original CRISPR TTTGATTTCCTAGCACAGCC TGG (reversed) Intronic
901310693 1:8267386-8267408 TTTGCCTTCCCAGAACAGCCTGG - Intergenic
902029688 1:13412892-13412914 TCTCATTTCCTAGCCCAGGCTGG - Intronic
904793635 1:33042591-33042613 GATGATTTTCTAGCACTGCCTGG + Intronic
905673680 1:39810120-39810142 ATTTATTTCCTGGCACAGCAAGG + Intergenic
906795828 1:48695818-48695840 TTTAGTTTCTAAGCACAGCCAGG + Intronic
908405561 1:63810983-63811005 TTTGATGTCCTTGCAGAACCTGG - Intronic
908826131 1:68134394-68134416 TGTGATTTCCCAGCACCCCCGGG - Intronic
909494975 1:76268452-76268474 TTTCCTTTCTGAGCACAGCCTGG + Intronic
909922616 1:81400863-81400885 TGTGATGTCTTAGCTCAGCCAGG + Intronic
911542776 1:99178494-99178516 TTTGCTTTCCTAGCACATTTTGG + Intergenic
914920917 1:151847064-151847086 TTTGATTTCCAACCACAGAAAGG + Intergenic
915394688 1:155573873-155573895 TACGATTGCCTAGCATAGCCTGG - Intergenic
920061350 1:203229036-203229058 TGTGGTTGCCTACCACAGCCAGG - Intronic
922178995 1:223219042-223219064 TTTCCTTTTCTACCACAGCCAGG - Intergenic
922966343 1:229694141-229694163 TGTGATTCCAAAGCACAGCCAGG - Intergenic
923195899 1:231667046-231667068 TATGATCCCCTTGCACAGCCTGG + Intronic
923751946 1:236754496-236754518 TTTGATCACCAAGAACAGCCAGG + Intronic
1063837222 10:10029525-10029547 TTTGAATTCCTTGCACATTCTGG - Intergenic
1064255244 10:13737921-13737943 TTTGATATCCTAGGACAAGCAGG - Exonic
1067701003 10:48572035-48572057 TTTGACCTCCTATCACAGCCAGG - Intronic
1068662328 10:59635495-59635517 TTTGATTTTACAGCACTGCCTGG - Intergenic
1070521492 10:77257570-77257592 TGTCCTTTCCTAGAACAGCCAGG - Intronic
1078261988 11:9718171-9718193 TTTGATTTGTTAGAATAGCCAGG + Intronic
1081233543 11:40617353-40617375 TTTCAGATCTTAGCACAGCCAGG - Intronic
1086389442 11:86347202-86347224 TTTGATTTCTTAGCAGACCAAGG - Intergenic
1086693656 11:89818527-89818549 TTTGATTTCCTTGTATAGTCAGG + Intergenic
1086712489 11:90026042-90026064 TTTGATTTCCTTGTATAGTCAGG - Intergenic
1087220876 11:95545146-95545168 TTTGATTTACTAGCTAGGCCAGG + Intergenic
1088758748 11:112909445-112909467 TTTGTTTTCATGTCACAGCCAGG + Intergenic
1089562790 11:119353418-119353440 TAAGATTTCCAATCACAGCCTGG + Intergenic
1089743415 11:120600548-120600570 TTTGTTTTCCTCCCACAGTCAGG + Intronic
1094639572 12:32261019-32261041 CTTGATTGCCTAGCCCAGTCAGG - Intronic
1099303147 12:80922544-80922566 CTTGGTTCACTAGCACAGCCTGG + Intronic
1099679898 12:85813911-85813933 CTTTATTTCCTAGGCCAGCCTGG + Intronic
1101071428 12:101080071-101080093 TCTGATTTACTGGCACAGCAAGG - Intronic
1101833975 12:108282116-108282138 TTTCATTTTGTAGCACAGCCAGG + Intergenic
1109765469 13:66890061-66890083 TTGTATTTCTTAGCAGAGCCCGG + Intronic
1110663791 13:78091488-78091510 TTTTATTTGCTAGCACAACAGGG + Intergenic
1111937339 13:94570683-94570705 TTTGATTTACTATCTCAGCCAGG - Intergenic
1112429687 13:99340324-99340346 TTTGCTGTCGTAGCACAGACCGG - Exonic
1113467179 13:110520549-110520571 GTTGTTTTCCTGGCACAGCAGGG + Intergenic
1116309209 14:43300398-43300420 TTTGAATAACTACCACAGCCAGG - Intergenic
1119557538 14:75565257-75565279 TGTGGTTTCCTGGCAAAGCCTGG - Intergenic
1119668263 14:76499691-76499713 GTTGGTTACCTGGCACAGCCAGG - Intronic
1119804512 14:77474249-77474271 TTTCATTTCCTGGACCAGCCGGG - Intergenic
1120132109 14:80819723-80819745 TTGGTTTTCCTAGAACAACCAGG - Intronic
1121787345 14:96672190-96672212 TTTGATTTCCTAGAACTACTTGG - Intergenic
1127897478 15:63314917-63314939 TTTTGTTTTCTAGCACATCCTGG - Intergenic
1128328461 15:66740452-66740474 CTTGATTTCTTTGCAGAGCCTGG + Intronic
1128679238 15:69635818-69635840 TTTGTCTTCCTTGGACAGCCTGG + Intergenic
1129115027 15:73360728-73360750 ATAGAGCTCCTAGCACAGCCTGG + Intronic
1129922487 15:79331672-79331694 TTTGAGTTCCTTGTACAGTCTGG - Intronic
1132413428 15:101603156-101603178 TCTGAGTTCCAAGCACAGACAGG + Intergenic
1133180466 16:4050416-4050438 TTTAATTTCCTAGCTATGCCAGG + Intronic
1137780685 16:51095571-51095593 TTTGATTTCAAAGCAAAGTCAGG + Intergenic
1141041452 16:80676100-80676122 TCGGATTTCCCATCACAGCCTGG + Intronic
1143358196 17:6346704-6346726 CTGGTCTTCCTAGCACAGCCTGG + Intergenic
1145038134 17:19555611-19555633 CTTGATTTCCCAGTACACCCTGG + Exonic
1145177761 17:20716168-20716190 TCTGCTTTCATGGCACAGCCTGG + Intergenic
1145737681 17:27244560-27244582 TCTGAATTCCTGGCACAGCAGGG - Intergenic
1146102669 17:29999703-29999725 TTTGGTTTGCTTGCTCAGCCAGG + Intronic
1146408227 17:32558253-32558275 ATTTATTTCTGAGCACAGCCAGG + Intronic
1149353850 17:55818991-55819013 TTTGATTTCTTTCCAGAGCCTGG - Intronic
1149414215 17:56441838-56441860 ATTGATTTCCTAACACAGTAAGG + Intronic
1149837467 17:59926114-59926136 TCTGCTTTCTTGGCACAGCCTGG + Intronic
1150081879 17:62247445-62247467 TCTGCTTTCTTGGCACAGCCTGG - Intergenic
1150200655 17:63353657-63353679 TTTTATTTCCCAGCTCACCCAGG - Intronic
1150320500 17:64209870-64209892 TTTAATGTTATAGCACAGCCTGG - Intronic
1152257309 17:79247758-79247780 TCTAAGTTCCAAGCACAGCCAGG - Intronic
1203166614 17_GL000205v2_random:102939-102961 TTTACTTTCCTGGCACATCCAGG - Intergenic
1153481456 18:5551352-5551374 TCTGTTTTACTAGCACAGACGGG + Intronic
1158587856 18:58756744-58756766 TGTGATGTCCTAGAATAGCCAGG + Intergenic
1158693662 18:59683906-59683928 TTTGAGGTCTTGGCACAGCCGGG - Intronic
1159408248 18:68034543-68034565 TTTCATTGCTTGGCACAGCCTGG + Intergenic
1161599581 19:5173356-5173378 TTTCAGTTACTAGCACAGCCTGG - Intronic
1162079042 19:8208238-8208260 TTTGATTTCCTCACACAGACAGG - Intronic
1162179628 19:8859210-8859232 TTTAAAATCCTAGCTCAGCCAGG - Intronic
1162724070 19:12679490-12679512 GTTGATCTCCTTGCCCAGCCGGG + Exonic
1163652022 19:18523337-18523359 TTCGATTTCCTTGCCCAGGCTGG + Intergenic
1165299606 19:34960492-34960514 TTGGAATTCCTGGCACAGTCAGG + Intronic
925110711 2:1334062-1334084 TTTGAGTTCCTTGCAGAGTCTGG - Intronic
927492183 2:23527900-23527922 CTTGATCTCCTGGCAGAGCCTGG - Intronic
929024111 2:37582749-37582771 CCTGAATTCCTATCACAGCCAGG + Intergenic
931711695 2:64993405-64993427 TTTGATTTCCCAGCACACAATGG + Intronic
931768776 2:65479734-65479756 TTTTATTCCCTGGCCCAGCCAGG + Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
935448086 2:103177858-103177880 TTTGTTTTACTAGCACTGCTGGG - Intergenic
937652250 2:124333710-124333732 TTTGATTTCAAGGCAGAGCCCGG + Intronic
938961221 2:136343369-136343391 GTTGAGTTCCAAGCACAGCTTGG - Intergenic
939501201 2:142987379-142987401 TTTGACCTCCTAGCACACACAGG + Intronic
940324797 2:152413775-152413797 TTTGCTTTCCTAACACTGCATGG + Intronic
940426062 2:153533279-153533301 TTTGTTTTTGTAGCCCAGCCTGG + Intergenic
944655738 2:201875007-201875029 TTTGATTTCCTAGCACAGCCTGG - Intronic
1170617800 20:17968453-17968475 TCTTCTTTCCTCGCACAGCCAGG - Exonic
1171057811 20:21924620-21924642 TTTGTATTCTTAGCAGAGCCAGG - Intergenic
1171205342 20:23274809-23274831 TTTGAGTTTCTGGCATAGCCTGG - Intergenic
1172182011 20:33009420-33009442 TTTGGTTTCCCACCAAAGCCAGG + Intronic
1173310630 20:41893445-41893467 CTTGCTTTCCTAGCGCAGCAAGG - Intergenic
1173862387 20:46292580-46292602 TTTGAGTTGCAGGCACAGCCAGG - Intronic
1176334931 21:5587627-5587649 TTTACTTTCCTGGCACATCCAGG + Intergenic
1176392826 21:6233321-6233343 TTTACTTTCCTGGCACATCCAGG - Intergenic
1176405139 21:6356158-6356180 TTTACTTTCCTGGCACATCCAGG + Intergenic
1176432018 21:6632946-6632968 TTTACTTTCCTGGCACATCCAGG - Intergenic
1176468593 21:7082853-7082875 TTTACTTTCCTGGCACATCCAGG + Intronic
1176492154 21:7464631-7464653 TTTACTTTCCTGGCACATCCAGG + Intergenic
1176508488 21:7673752-7673774 TTTACTTTCCTGGCACATCCAGG - Intergenic
1177680684 21:24365663-24365685 CTAGATTTCCTGGCATAGCCAGG - Intergenic
1178320910 21:31605030-31605052 CTTGTTTTCGTAGGACAGCCTGG + Intergenic
1179669637 21:42937590-42937612 TTTGTTTTCCTTTCACAGGCAGG - Intergenic
1180579492 22:16818229-16818251 TTTGACTTCCTAGGACTTCCAGG + Intronic
1180833309 22:18917352-18917374 TTTTATTTCCTTGCAGGGCCAGG - Intronic
1181431013 22:22881839-22881861 TGTGACATCATAGCACAGCCTGG + Intronic
1181663056 22:24367735-24367757 TTTGATTTCCTAGCGCACTTTGG + Intronic
1181913025 22:26255608-26255630 TGAGATTTCCTAGCAGAGACAGG - Intronic
1183262188 22:36802734-36802756 TTTCCTATCCTAGGACAGCCTGG - Intronic
1184951303 22:47844385-47844407 TTTTCTTTCCTAACAGAGCCAGG - Intergenic
1185305334 22:50112309-50112331 TCTTATTTCCTGGCACCGCCAGG - Intronic
1203283395 22_KI270734v1_random:142656-142678 TTTTATTTCCTTGCAGGGCCAGG - Intergenic
949447239 3:4147952-4147974 TGTGATTTCCTAGCATAGTGCGG - Intronic
951727684 3:25778212-25778234 TTTCATTTCCTACTACAGACAGG + Intronic
952878635 3:37969292-37969314 TGTGATATCACAGCACAGCCAGG - Intronic
954357087 3:50090862-50090884 ATTGATTGCTTACCACAGCCAGG - Intronic
954854945 3:53635861-53635883 TTTGATTCCTTAGGACAGGCAGG + Intronic
955561367 3:60194702-60194724 TTTGAGTTCCTAGCAGATTCTGG - Intronic
956623708 3:71246405-71246427 TTTTATTTGCTAGATCAGCCTGG - Intronic
961350480 3:126298324-126298346 TTTGATTTCCTTGCAGATTCTGG + Intergenic
967014550 3:185469968-185469990 TGTGGTTTCCAAGCAAAGCCTGG + Intronic
967685480 3:192411033-192411055 TATGATTTCCAAGCACAGACAGG + Intronic
969848708 4:9940006-9940028 TTTTATTTCATAGCACAGTAGGG - Intronic
970342943 4:15125939-15125961 TATGATCTTCTAGCATAGCCAGG + Intergenic
973224802 4:47771203-47771225 GTTGACTTCCTGGTACAGCCAGG - Intronic
974332337 4:60496909-60496931 ATTGATGTCCTAGCTCAGTCAGG + Intergenic
974746573 4:66085769-66085791 TTTTATTTCTTAGCTTAGCCAGG + Intergenic
975371663 4:73595936-73595958 TTTAATTTCATGGCACAGCATGG - Intronic
976120527 4:81775757-81775779 TTTGAGTTCCTAGTATATCCTGG + Intronic
981786060 4:148480917-148480939 TTTGTTTTCTTAGTAAAGCCGGG - Intergenic
981942089 4:150292574-150292596 TGTGATTTTCTGGCCCAGCCAGG - Intronic
984213606 4:176880429-176880451 TTTGTTTTCCTACCAGGGCCAGG + Intergenic
986926981 5:12766527-12766549 TTTGTTTTTTTAGCACAGACAGG - Intergenic
988720787 5:33877122-33877144 TTTGATTTCCCAGCAGGGGCTGG + Intronic
989231338 5:39090481-39090503 TTTGAGTTCCTAGCATATTCTGG - Intergenic
992502653 5:77357478-77357500 TTTTTTTTCCTGGCACAGCCTGG + Intronic
993593342 5:89823281-89823303 TTTTATTTCCTAACAAAGCATGG - Intergenic
994667657 5:102725945-102725967 CTTTGTTTCCTAGCCCAGCCAGG - Intergenic
995243781 5:109914832-109914854 TCTCTTTTCCTAGAACAGCCTGG + Intergenic
995776920 5:115733567-115733589 TTTCATCTCCTAGCAAGGCCAGG + Intergenic
998198797 5:140100860-140100882 TTTGAGTTCCTTGTACATCCTGG + Intergenic
1006801068 6:36759909-36759931 TTTTATTTACATGCACAGCCAGG + Intronic
1007139915 6:39561692-39561714 TTTGCTTTCCTAACTCAGCAAGG + Intronic
1007391198 6:41550384-41550406 ATTAATTTGCTAGCACTGCCAGG + Intronic
1009313766 6:62191100-62191122 TTTGAATGCTTAGTACAGCCAGG - Intronic
1013223734 6:108104056-108104078 TTAGATTTCCTAGTCTAGCCAGG - Intronic
1014605811 6:123472523-123472545 TTTGTTTTCCTAAGAAAGCCTGG - Intronic
1018952206 6:168386555-168386577 TGTGAGTCCCTACCACAGCCTGG + Intergenic
1019216877 6:170449619-170449641 TTTGATTTCCTTGTACATTCAGG + Intergenic
1024676252 7:51640329-51640351 TTTGATTTCCTATTCCTGCCAGG - Intergenic
1025605263 7:63035603-63035625 TTTAAATTTCTAGCATAGCCTGG + Intergenic
1027756557 7:82221447-82221469 TTAGATTTCCAACCTCAGCCGGG + Intronic
1030040186 7:105442515-105442537 TTTGAATTTCTAGTACAGACGGG + Intronic
1030924826 7:115438944-115438966 TTTTATTTCCAAGCATAGACAGG - Intergenic
1032024682 7:128431530-128431552 ATTGCTTTACTAGCAAAGCCCGG - Intergenic
1032308592 7:130760063-130760085 TATAATCTCCCAGCACAGCCGGG - Intergenic
1032492872 7:132337342-132337364 TTTGATGTGCTTCCACAGCCAGG - Intronic
1032743204 7:134760210-134760232 TTTGATTTCCTACCACACTCAGG - Intronic
1033713965 7:143980695-143980717 CTTGATTTCCCTGCACAGCTGGG + Intergenic
1039043582 8:33430324-33430346 TTGGTTTTCCTAGCACTCCCTGG - Intronic
1040596062 8:48838936-48838958 TTTGATTTTCTAACTCAGCTTGG - Intergenic
1043490679 8:80745963-80745985 TTTAATTTCCTGGGACAGCTCGG + Intronic
1044665346 8:94628929-94628951 TTTGTTTTCCTAATGCAGCCTGG + Intergenic
1044884035 8:96757174-96757196 TTTGTATTTCTAGCACAGACGGG - Intronic
1044965406 8:97569243-97569265 TTTTATTTTCTTGCACAGCAGGG - Intergenic
1044989306 8:97781447-97781469 TTTGTTTTCCTAGTAGAGACAGG + Intronic
1045920371 8:107522041-107522063 TTCTTTTTCCTAGCACTGCCAGG + Intergenic
1046258094 8:111727386-111727408 ATTTATTTCCTGGCACTGCCTGG + Intergenic
1046437018 8:114204030-114204052 TTTGAGTTCCTTGTACATCCTGG - Intergenic
1047588038 8:126295736-126295758 TTTTATTTCCTAGTAGATCCAGG + Intergenic
1047622227 8:126619818-126619840 TTTGATTTCCTAGACCAAACAGG - Intergenic
1048067452 8:130984650-130984672 TTTCCTTTACTAGCACTGCCTGG - Intronic
1048199449 8:132359765-132359787 TTTGTTTTCCAGGCACACCCAGG + Intronic
1052588337 9:30457934-30457956 TTTGAGTTCCTTGCAAATCCTGG - Intergenic
1055685230 9:78766261-78766283 TTTGATTTACTATTCCAGCCTGG + Intergenic
1056206267 9:84322410-84322432 TTTGATTTCATAGAACAGGAAGG - Intronic
1059011395 9:110465640-110465662 TTTGTGTTCCTAACCCAGCCCGG + Intronic
1061602008 9:131676407-131676429 TTGGAGATCTTAGCACAGCCGGG - Intronic
1061722426 9:132560876-132560898 TTTGTTTTCCAAGCAGAGCTTGG + Intronic
1203426707 Un_GL000195v1:47293-47315 TTTTACTTCCTGGCACATCCAGG - Intergenic
1203439521 Un_GL000195v1:175766-175788 TTTACTTTCCTGGCACATCCAGG + Intergenic
1186920875 X:14278758-14278780 TTTGATTTCCTTGTACATTCTGG - Intergenic
1191615982 X:63169427-63169449 TCTGCTTTCCTATCACACCCCGG - Intergenic
1191620316 X:63209496-63209518 TCTGCTTTCCTATCACACCCCGG + Intergenic
1192879817 X:75271765-75271787 TTTGAGTTCCTCGTACATCCTGG - Intergenic
1193966522 X:87993776-87993798 TTTGAGTTCCTAGTAGATCCTGG + Intergenic
1194313784 X:92348250-92348272 TTTGATTTTCTGACCCAGCCCGG - Intronic
1194775643 X:97960594-97960616 ATTTAGTACCTAGCACAGCCTGG + Intergenic
1196966235 X:121058491-121058513 TTTGATTTCCTTGCATATTCTGG + Intergenic
1197334444 X:125194726-125194748 TTTTATTTCCTATCCGAGCCTGG - Intergenic
1198043749 X:132879463-132879485 TTTGAAATCCTATCACATCCTGG + Intronic
1200622053 Y:5462365-5462387 TTTGATTTTCTGACCCAGCCCGG - Intronic