ID: 944656950

View in Genome Browser
Species Human (GRCh38)
Location 2:201885006-201885028
Sequence GAGTGGGCCTTGAAAGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944656949_944656950 -8 Left 944656949 2:201884991-201885013 CCAGGATGATTTTGTGAGTGGGC 0: 1
1: 0
2: 0
3: 9
4: 113
Right 944656950 2:201885006-201885028 GAGTGGGCCTTGAAAGATGATGG 0: 1
1: 0
2: 0
3: 6
4: 211
944656946_944656950 6 Left 944656946 2:201884977-201884999 CCAGCTGTGGGGATCCAGGATGA 0: 1
1: 1
2: 3
3: 15
4: 198
Right 944656950 2:201885006-201885028 GAGTGGGCCTTGAAAGATGATGG 0: 1
1: 0
2: 0
3: 6
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944656950 Original CRISPR GAGTGGGCCTTGAAAGATGA TGG Intronic
900897988 1:5497237-5497259 TTGTGGCCCTTGAAGGATGAGGG - Intergenic
901336764 1:8455873-8455895 GAGTGGCCCATGACTGATGAAGG - Intronic
903140741 1:21337839-21337861 GAGTGGGCCTTGGAGACTGATGG - Intronic
904049613 1:27631364-27631386 GTGTGGGCCTCGAAAAAGGATGG - Intronic
904072431 1:27811794-27811816 GAGAGTGCCCTGGAAGATGATGG + Intronic
904495234 1:30882713-30882735 GAGTGGGCTCTGAGAGAGGATGG - Intronic
906257517 1:44361648-44361670 GAGTGGGTTTGGAAAGATAAAGG - Intergenic
906379850 1:45325880-45325902 GAGTGGCCCTTGAAGGGTTAGGG - Intergenic
908564976 1:65345057-65345079 GAGTGGGCTTTTACAGATGATGG + Intronic
910664339 1:89708187-89708209 GAGTTGTCCTTGAAAGAAAATGG + Intronic
910737599 1:90478071-90478093 GAGTGGGCCTAGAAAGGGGCAGG - Intergenic
911829390 1:102531810-102531832 GAATTGGCCTGGAAAGATGATGG + Intergenic
913101000 1:115565534-115565556 AAATGGGCCATGAAAGATGGGGG - Intergenic
913578178 1:120197729-120197751 GAGATGGGCATGAAAGATGAAGG + Intergenic
913629993 1:120700629-120700651 GAGATGGGCATGAAAGATGAAGG - Intergenic
914428327 1:147599350-147599372 GAGGTGGCCTTGAAGGTTGAGGG + Intronic
915124664 1:153655472-153655494 GAGAGGGCCTTGGAGGTTGATGG - Intergenic
915230417 1:154441732-154441754 GTCTGGGCCTTGAGAGCTGAAGG - Intronic
917515663 1:175705935-175705957 GACTGGGCCTTGAAAAATCTTGG - Intronic
918115836 1:181496789-181496811 GAGTGGGCCTAAAAAGTTAAAGG + Intronic
918325898 1:183410525-183410547 TAGTGGGCCTCGAAAGGTGATGG - Intronic
918805396 1:189034579-189034601 GAATGTGCTTTGAAATATGAAGG - Intergenic
922449885 1:225728464-225728486 GAGTGTGCATTGAAAGGGGAGGG + Intergenic
922851419 1:228736214-228736236 GAGTGGGCTTGGAGAGAGGAGGG + Intronic
923042756 1:230331553-230331575 GAATTGGCCTTGCAAGCTGAAGG - Intronic
924111728 1:240706545-240706567 AACTGAGACTTGAAAGATGAGGG - Intergenic
1064798516 10:19041287-19041309 GAATGGGTCTTGAAAAATAATGG - Intergenic
1066196647 10:33106699-33106721 GAGGGGAGCTGGAAAGATGATGG - Intergenic
1067089285 10:43258433-43258455 GGGTTGGCCATGAAAGAGGAGGG - Intronic
1067804462 10:49383370-49383392 GAGTGGGCCATGGAAGGGGAAGG + Intronic
1071982776 10:91020500-91020522 GAGTGGGCAATTAAACATGAAGG + Intergenic
1074232768 10:111554288-111554310 GAGAGGGCTTTGCAGGATGACGG + Intergenic
1074629829 10:115239940-115239962 GAGTGGGAGTTGAGGGATGAAGG + Intronic
1075017613 10:118921832-118921854 TAGTGGGCCTAGAAAGAACAAGG + Intergenic
1076506916 10:130984438-130984460 GCGTGGGCCTTTAAGGAGGAAGG + Intergenic
1077134099 11:990205-990227 CAGTGGGCCTGGGAAGTTGAGGG + Intronic
1077149736 11:1065665-1065687 AAGTGCCCCTTGACAGATGAAGG + Intergenic
1077647034 11:3934390-3934412 AACTGGGCCTTCAAGGATGAGGG - Intronic
1078005496 11:7529508-7529530 GAGATGGCCTTGAGAGAAGATGG - Intronic
1078907355 11:15699946-15699968 GAGTGGGCCTTGTGTGTTGAAGG - Intergenic
1079123888 11:17705075-17705097 GGGTGGGCCATGAAAGGAGAGGG + Intergenic
1079410381 11:20182038-20182060 GAATGGGGCTTGAGATATGAAGG + Intergenic
1080278714 11:30531920-30531942 GAGTGGGGCTTGAAATCTGTTGG - Intronic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1082698172 11:56396536-56396558 GAGGTGGCCTTGAAGGATGACGG - Intergenic
1083553401 11:63607599-63607621 GTTTCGGTCTTGAAAGATGAGGG + Intronic
1083665495 11:64271879-64271901 GAGTGGGCCTGCAGAGCTGATGG - Intronic
1084927460 11:72524924-72524946 AAGTGGCCATGGAAAGATGAAGG + Intergenic
1088461166 11:110084631-110084653 GAGAGAGCCATAAAAGATGAGGG + Intergenic
1088691719 11:112334229-112334251 CAGTGGGCTTTGGAAGAGGAAGG + Intergenic
1091435577 12:470182-470204 GACTGAGCCTTGAAAGACCAGGG - Intronic
1091724232 12:2834528-2834550 GAGCGGGACCTGAAAGCTGAGGG + Intronic
1092284245 12:7119716-7119738 GAGTGCGCCCTGACAGATGCTGG - Intergenic
1092783077 12:12005213-12005235 AAGTGGGACTTGAAAGCAGAAGG - Intergenic
1094454265 12:30614625-30614647 AAGTGGGAGTTGAATGATGAGGG - Intergenic
1095332654 12:40987029-40987051 TAATGGGCTTTGAAAGATGGTGG + Intronic
1095988223 12:48014963-48014985 GAATTGGGCTTGAAAGATGAAGG + Intergenic
1101975245 12:109352352-109352374 GAGTGGGAGGTGAGAGATGAGGG - Intronic
1103223047 12:119262237-119262259 GGGAGGGGCTTGAAAGCTGAGGG + Intergenic
1103980817 12:124736059-124736081 GGGGGAGCCTTGAGAGATGATGG - Intergenic
1104875855 12:132034301-132034323 GAGGTGGCCTTGAAGGATGCAGG + Intronic
1107676628 13:42804492-42804514 GGGAGGGACTGGAAAGATGAGGG - Intergenic
1109874477 13:68382079-68382101 GAGTGGGCCCTGTAAGACAATGG - Intergenic
1112206225 13:97325883-97325905 CAGTGGTGCTTGAAAGAAGAGGG + Intronic
1112937927 13:104824200-104824222 GAATGGGACTTGAAAGAGGGAGG + Intergenic
1114210507 14:20609978-20610000 TAGTGCGGCTTAAAAGATGAAGG + Intergenic
1114234173 14:20810399-20810421 GAGTGGTGTTTGAAAGTTGAAGG + Intergenic
1115045518 14:28988139-28988161 GAATGGGGGTTGAATGATGAGGG + Intergenic
1116626572 14:47272455-47272477 GAGGGGGAGTTGAAAGACGAAGG + Intronic
1117340915 14:54790302-54790324 CAGTGGGCGATGAAAGATGTAGG + Exonic
1119515844 14:75247607-75247629 ACGTGGGCCATGAAAGGTGAGGG + Intronic
1125262705 15:37845993-37846015 GACCGGGCCTGTAAAGATGAAGG + Intergenic
1127903132 15:63355777-63355799 GAATGGGCCAAGGAAGATGAAGG - Intronic
1128236138 15:66068638-66068660 CAGTGGGCCATGAAAGACAAGGG - Intronic
1129153924 15:73705775-73705797 GAGAAGGCCTTGAAGGATAAGGG + Intronic
1129908033 15:79203421-79203443 GGGTGGGCCTTTAAAGAACAAGG + Intergenic
1130354063 15:83114057-83114079 ATGTGGGCCTTGAAAGCAGACGG - Intronic
1130647354 15:85740908-85740930 GAGACGGGCTTGAAAAATGAGGG + Intronic
1131456235 15:92584710-92584732 GAGTGGGATCTGAAAGACGATGG - Intergenic
1132082166 15:98875670-98875692 GAATTTGCTTTGAAAGATGAAGG - Intronic
1135250822 16:20900145-20900167 GGGGGGGCATTGAGAGATGAAGG - Intronic
1137823346 16:51466314-51466336 GAGTGGGCCCTTCCAGATGAAGG - Intergenic
1137920130 16:52478801-52478823 GACTGGGCTTTGCAAGAAGAAGG + Intronic
1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG + Intergenic
1140197745 16:72869295-72869317 GGCTGGTCCTTGAAGGATGATGG - Intronic
1141215723 16:82021293-82021315 CAGTGGGCCATGAAGCATGATGG + Intergenic
1142984929 17:3690019-3690041 GGGTGGGCCTTGGTCGATGAGGG - Intronic
1145240315 17:21237109-21237131 GGCTGGGGCCTGAAAGATGAGGG - Intergenic
1145744487 17:27304890-27304912 GTATGGGACCTGAAAGATGATGG + Exonic
1147051496 17:37798279-37798301 GATTGGATCTTGAAAGATGCTGG - Intergenic
1149259720 17:54865496-54865518 GAGTGAGCCGTCAAAGAGGAGGG + Intergenic
1149444721 17:56704825-56704847 CTGTGGGCCTTGAAAGAGAAAGG + Intergenic
1151231739 17:72690024-72690046 GAGGGGGCCTTGCAAGCTGCAGG + Intronic
1151541623 17:74767659-74767681 AGGAGGGCCTTGAAAGAAGAAGG - Intronic
1157560187 18:48640120-48640142 AAGGGAGCCTTGAAGGATGAAGG - Intronic
1158098203 18:53799041-53799063 GAGTGGGCCTTGACTGAGAAAGG - Intergenic
1158686135 18:59616306-59616328 GAGGCGGCCCTGAAAAATGATGG + Intronic
1161737837 19:6002521-6002543 CAGAGGGCCCTGAGAGATGATGG + Intronic
1162430551 19:10625721-10625743 GAGGGGGCCTTGAGAGAACATGG + Intronic
1164581304 19:29437041-29437063 GAGTGGGGCTGGAGAGATGGAGG + Intergenic
1166136492 19:40780304-40780326 GAGAGGGCCTTGGAGGATGGGGG + Intronic
1167738595 19:51311433-51311455 GATTGGGACTTGAAGGAGGAGGG + Intergenic
1168387146 19:55973743-55973765 GAAAACGCCTTGAAAGATGAAGG + Exonic
925543236 2:4989260-4989282 CAGTGCCCCTTGAAATATGAAGG - Intergenic
926803718 2:16685292-16685314 GATGGGGCCTTGACAGAGGAAGG - Intergenic
927362276 2:22249893-22249915 GAATGGGCTTTGGAGGATGAAGG - Intergenic
928701623 2:33904064-33904086 GAGGGGGGATTGAGAGATGACGG - Intergenic
928775923 2:34763337-34763359 GAGTGTGCCTAGAAAACTGATGG - Intergenic
929247592 2:39719798-39719820 TGGTAGTCCTTGAAAGATGAGGG - Intergenic
929460199 2:42097698-42097720 AAGTGGGCCTTGAAAGGCGGTGG - Intergenic
930391825 2:50771142-50771164 GAGAGTGCCTGGAAGGATGATGG + Intronic
931897915 2:66753866-66753888 GAGTGAGAGTTGAAAGATAACGG - Intergenic
934034332 2:88076525-88076547 TAGAGGGCCTTAAAAGATAAAGG - Intronic
934688439 2:96338595-96338617 CAGTGGTCCTTGTAAGAGGAAGG + Intronic
939974642 2:148703495-148703517 GAGTGAGGCCTGAAAAATGAGGG + Intronic
941642904 2:168008270-168008292 GAGAGGGGCTTGAAACGTGATGG + Intronic
941667020 2:168252423-168252445 GAGTTGGCCATGACAAATGACGG - Intergenic
944656950 2:201885006-201885028 GAGTGGGCCTTGAAAGATGATGG + Intronic
948526498 2:238574064-238574086 AGGTGGGACTGGAAAGATGAGGG - Intergenic
1169363096 20:4968233-4968255 GGGTTAGCCTTGAAAGATGGCGG + Intronic
1173802839 20:45905364-45905386 GAGTGGGCCTTGAAAGCTAGAGG + Intronic
1175890502 20:62313827-62313849 GAGTGGGCACGGAGAGATGAGGG + Intronic
1175890509 20:62313855-62313877 GAGTGGGCACGGAGAGATGAGGG + Intronic
1175890516 20:62313883-62313905 GAGTGGGCACGGAGAGATGAGGG + Intronic
1175890592 20:62314192-62314214 GAGTGGGCATGGAGAGGTGAAGG + Intronic
1179106290 21:38403646-38403668 GAGTGGGCGGTGAAAGAATATGG - Exonic
1179572598 21:42286776-42286798 GAGAGGTCCTGGAGAGATGAGGG + Intronic
1183056831 22:35311944-35311966 GGGTGGGGCTTAGAAGATGAGGG + Intronic
1184275915 22:43409801-43409823 GAATGGTCCCTAAAAGATGAGGG - Intergenic
1185146574 22:49140196-49140218 GGGTGGGACATGAAAGCTGAGGG - Intergenic
950078561 3:10205207-10205229 GTGGGGGCCTTTAAAGATTATGG + Intronic
951421466 3:22490892-22490914 CAGTAGGAATTGAAAGATGAAGG - Intergenic
952503078 3:33982291-33982313 GAGTAGGCCAAGAAAGAGGAAGG - Intergenic
954403894 3:50334407-50334429 GTGTGGGCCCTGGAAAATGAGGG + Intronic
955338878 3:58109432-58109454 TGGTGGGCCTTGAATGATGGAGG + Intronic
956504668 3:69924976-69924998 GAGAGGACTTTAAAAGATGAAGG - Intronic
956694781 3:71908884-71908906 AAATGGGCCATGAAAGCTGAAGG + Intergenic
957219099 3:77359518-77359540 TAGTGAGCCTTCAAAAATGAAGG + Intronic
957320549 3:78624845-78624867 AATAGGGCTTTGAAAGATGAGGG + Intronic
960880993 3:122344654-122344676 GTGGGGCCCTTAAAAGATGATGG - Intergenic
963536614 3:146537427-146537449 GAGTGGGCCTGGGAAGGGGATGG - Intronic
964105724 3:153037336-153037358 CAGTGGGCTTTGACAGATAAGGG + Intergenic
964360179 3:155887585-155887607 GTGTGGTCCTTGATAGATTATGG + Intronic
967171120 3:186824572-186824594 GCTTGAGCCTGGAAAGATGAAGG - Intergenic
967369867 3:188731953-188731975 GAGTGAGCAAAGAAAGATGAGGG + Intronic
967553806 3:190831446-190831468 GAGGGGGCCCTGGAAGAGGAGGG - Intergenic
969839378 4:9869477-9869499 GAGGGGGCATTGTAAGAGGAAGG - Intronic
971062300 4:22985914-22985936 GAGTGGGGTTTGAAATAAGATGG + Intergenic
972683828 4:41332532-41332554 GAGTGGGACTTGGAAGAAAAGGG + Intergenic
976950310 4:90820430-90820452 GATGGTGCCTTGAAAGCTGAGGG + Intronic
981029300 4:140108022-140108044 GATTGGGGATTCAAAGATGATGG - Intronic
983523697 4:168738073-168738095 GAAATGGCCTTGAAAGCTGAAGG - Intronic
986137231 5:4992095-4992117 ATGTGGGTCTTGAAAGAAGAGGG - Intergenic
986506755 5:8459541-8459563 CGCTGTGCCTTGAAAGATGAAGG + Intergenic
987162178 5:15155762-15155784 GAGTGAAACTTGAAAGGTGAGGG + Intergenic
989187617 5:38640408-38640430 GGGTGGGGCTTGAGAGAAGAAGG - Intergenic
990608785 5:57437092-57437114 GAGCCAGCCCTGAAAGATGATGG - Intergenic
991637501 5:68721133-68721155 AAGTGGGTTTTAAAAGATGATGG - Intergenic
993638878 5:90378675-90378697 GAGTGAGCCAGGAAAGCTGAAGG - Intergenic
994000499 5:94773532-94773554 GAGTGGGTTTTGTAATATGATGG + Intronic
995949919 5:117699165-117699187 GAGTGGGAAATGAGAGATGAGGG - Intergenic
996605466 5:125315474-125315496 GAATGGGCCTGAAAAGATAATGG - Intergenic
998556182 5:143126041-143126063 GGGAGTGCCTTGAAAAATGAAGG - Intronic
1000844338 5:166260633-166260655 GAGTGTCCCTTGGAAGATGGTGG - Intergenic
1001299453 5:170523474-170523496 GAGTCGACTTTGAAAGAAGAGGG + Intronic
1001484787 5:172111569-172111591 GAGTGTCCCTTGATAGCTGATGG + Intronic
1003651751 6:7967249-7967271 GAGAGGGCACTGAAAGAAGAGGG + Intronic
1007175125 6:39891223-39891245 GAGGGTGCCTTGAAAGAGGGAGG - Intronic
1007389874 6:41545089-41545111 CAGTGGTCCTTGAAAGAAAAGGG - Intergenic
1013071764 6:106735967-106735989 GAATGAGCCTTGACAGATGCAGG + Intergenic
1013154000 6:107475820-107475842 AGCTGGGCCTTGAAGGATGATGG - Intergenic
1013154289 6:107478190-107478212 AGCTGGGCCTTGAAGGATGATGG + Intergenic
1014947437 6:127515454-127515476 GAGTGGGCCTGGGAGGATTAGGG - Intronic
1015803992 6:137090222-137090244 GAGGGGGCGATGAAATATGAGGG + Intergenic
1019482888 7:1274536-1274558 GAGTGGACCCTGAAGGATGGGGG - Intergenic
1021194512 7:17660415-17660437 GAGTGGGCTTTGAAAGACTGTGG + Intergenic
1021530025 7:21633760-21633782 GGGAGGGCCTTAGAAGATGATGG + Intronic
1022346977 7:29526265-29526287 GAGTGTGCCTTGCATGTTGAAGG - Intergenic
1023553058 7:41389409-41389431 AAGTGGGCCTTGAAAGACTGCGG + Intergenic
1028801777 7:94974097-94974119 TAGTAGGCTTTGAGAGATGAAGG + Intronic
1032398623 7:131608369-131608391 GAGGGGTCATTGAAAGGTGAGGG + Intergenic
1032576209 7:133057912-133057934 GAGTGGGCATTATAAGATTATGG - Intronic
1034907756 7:154965563-154965585 GAGTGGGCCTAGGAGGAGGAGGG - Intronic
1035073075 7:156158967-156158989 CTGGGGGCCTGGAAAGATGAGGG - Intergenic
1035075856 7:156176839-156176861 GAGGGGGCCTTGAATGAGGTGGG + Intergenic
1035477563 7:159154046-159154068 CAGTGGACCTTGAACGAAGAGGG - Intergenic
1036796816 8:11762153-11762175 GAATGGACTTTGAAAAATGAGGG - Exonic
1037578781 8:20232304-20232326 GAAGGGGCCTGGAGAGATGAAGG + Intergenic
1038076436 8:24080346-24080368 GGGTGGGCCTGCAAAGGTGAAGG + Intergenic
1038311735 8:26450134-26450156 GCTTGGGCCTGGAAAGATGGGGG + Intronic
1039045989 8:33449866-33449888 AAGTGGGCCTTGAAGGATATTGG - Intronic
1039720793 8:40162092-40162114 GACAGGGCCTTGAAAGAGGTTGG - Intergenic
1042097869 8:65238241-65238263 GAGTAGGCCTTGAATGTTAATGG + Intergenic
1043768214 8:84163976-84163998 AACTGGGCATTAAAAGATGAAGG - Intergenic
1043916198 8:85925351-85925373 GAGTGGGCCTTGAACAAAGTTGG - Intergenic
1045712272 8:104999005-104999027 GAGAGCTTCTTGAAAGATGATGG + Intronic
1048982450 8:139710103-139710125 GAGAGGGCCTTGAAGGAGGGGGG - Intergenic
1049703228 8:144024341-144024363 GAGAGGGTCCTGAAAGAAGAGGG - Intronic
1049703323 8:144024651-144024673 GAGAGGGTCTTGAGAGAAGAGGG - Intronic
1050306594 9:4311539-4311561 GAGTGGGCCCTGACAGTTGCAGG - Intronic
1053022169 9:34702214-34702236 AATTGGTCCTAGAAAGATGAAGG + Intergenic
1053311938 9:37025976-37025998 GAGGGGGCTTTGAAAAATCAAGG - Intronic
1053665898 9:40317338-40317360 GAGTGGGGGTTGGAAGATGGGGG + Intronic
1053915476 9:42942383-42942405 GAGTGGGGGTTGGAAGATGGGGG + Intergenic
1054377052 9:64457366-64457388 GAGTGGGGGTTGGAAGATGGGGG + Intergenic
1054518713 9:66058945-66058967 GAGTGGGGGTTGGAAGATGGGGG - Intergenic
1055096983 9:72423857-72423879 GGGAGGGCCTTGAAAGAGCAAGG + Intergenic
1057844012 9:98507938-98507960 GTGAGGTCCTTGAAAAATGAGGG - Intronic
1058628612 9:106962009-106962031 GGATCGGCCTGGAAAGATGAAGG + Intronic
1058797369 9:108511678-108511700 AACTAGGCCTTGAAAAATGATGG - Intergenic
1059263894 9:113007596-113007618 GAGTCAGCCTTGAAAGAGAAAGG - Intergenic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1062551547 9:137089772-137089794 GAGTGGGCCTTGGGAGAAGGAGG + Intronic
1192380171 X:70608231-70608253 GAGTTGGACTTGAAAGTTGTAGG - Intronic
1195925944 X:110024737-110024759 AAGAGGGCCTTGGGAGATGATGG + Intronic
1198508521 X:137325839-137325861 AGCTGGGTCTTGAAAGATGAGGG - Intergenic
1198691399 X:139288746-139288768 GGGTGGGTCTTGAAAGCTTAAGG + Intergenic
1199665526 X:150093617-150093639 GGCTGGGCCCTGAAAGAAGAAGG - Intergenic