ID: 944657592

View in Genome Browser
Species Human (GRCh38)
Location 2:201891517-201891539
Sequence CCAACCATCCTGGTTTACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 10, 2: 54, 3: 139, 4: 349}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944657592_944657598 8 Left 944657592 2:201891517-201891539 CCTGGGTAAACCAGGATGGTTGG 0: 1
1: 10
2: 54
3: 139
4: 349
Right 944657598 2:201891548-201891570 GTGGCACAAATTACCTTCCAGGG 0: 1
1: 0
2: 2
3: 9
4: 101
944657592_944657604 27 Left 944657592 2:201891517-201891539 CCTGGGTAAACCAGGATGGTTGG 0: 1
1: 10
2: 54
3: 139
4: 349
Right 944657604 2:201891567-201891589 AGGGTAATCTTGAGGAGGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 232
944657592_944657599 19 Left 944657592 2:201891517-201891539 CCTGGGTAAACCAGGATGGTTGG 0: 1
1: 10
2: 54
3: 139
4: 349
Right 944657599 2:201891559-201891581 TACCTTCCAGGGTAATCTTGAGG 0: 1
1: 1
2: 1
3: 12
4: 146
944657592_944657601 22 Left 944657592 2:201891517-201891539 CCTGGGTAAACCAGGATGGTTGG 0: 1
1: 10
2: 54
3: 139
4: 349
Right 944657601 2:201891562-201891584 CTTCCAGGGTAATCTTGAGGAGG 0: 2
1: 0
2: 0
3: 7
4: 130
944657592_944657597 7 Left 944657592 2:201891517-201891539 CCTGGGTAAACCAGGATGGTTGG 0: 1
1: 10
2: 54
3: 139
4: 349
Right 944657597 2:201891547-201891569 TGTGGCACAAATTACCTTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 114
944657592_944657603 26 Left 944657592 2:201891517-201891539 CCTGGGTAAACCAGGATGGTTGG 0: 1
1: 10
2: 54
3: 139
4: 349
Right 944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 171
944657592_944657605 28 Left 944657592 2:201891517-201891539 CCTGGGTAAACCAGGATGGTTGG 0: 1
1: 10
2: 54
3: 139
4: 349
Right 944657605 2:201891568-201891590 GGGTAATCTTGAGGAGGAAGGGG 0: 1
1: 1
2: 1
3: 21
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944657592 Original CRISPR CCAACCATCCTGGTTTACCC AGG (reversed) Intronic
901472335 1:9466257-9466279 CCAACCATCCCGGTTTGCCTGGG - Intergenic
902293383 1:15449681-15449703 ACAACCATCTTGGTTTGCCTGGG - Intergenic
902296144 1:15468295-15468317 CCAACCATCATGGTTTGCCCAGG + Intronic
902298984 1:15487879-15487901 CCAACCATCCCAGTTTGCCCAGG + Intronic
902829796 1:19004777-19004799 CCAACCATCCCGGTTTGCCCAGG - Intergenic
903793829 1:25913412-25913434 CCAACTCTCCTGGTTTACCAGGG + Intergenic
904273132 1:29363378-29363400 CCAACCCTCCTGGTTTGTCCAGG + Intergenic
905219253 1:36432811-36432833 CCAGAAATCCTGGTTTGCCCAGG - Intronic
905806600 1:40881725-40881747 CCAACCATCCAGGTTTGCCCAGG - Intergenic
906376424 1:45300267-45300289 CCAACCATCCCAGTTTTCCCAGG - Intronic
906538449 1:46565640-46565662 CCAACCATCCCAGTTTTCCCAGG - Intronic
906551576 1:46670129-46670151 ACCAACATCCTGGTTTGCCCAGG - Intronic
906634145 1:47397083-47397105 CCAACCAGCCTGGTTTGCGCAGG + Intergenic
907497315 1:54853612-54853634 CCCACCTCCCTGGTCTACCCAGG - Exonic
907545864 1:55259354-55259376 TCAACCATTCTGGTTTGCTCAGG - Intergenic
907546272 1:55262598-55262620 CCAACCACCCCAGTTTACCCAGG - Intergenic
907871313 1:58445975-58445997 GCAACCATTCTGATTTGCCCAGG + Intronic
910691483 1:89969924-89969946 CCAACAATCCTGGTTTTCCTTGG - Intergenic
911123235 1:94316543-94316565 CCAATCATCCTGGTTTTCTTGGG + Intergenic
911175499 1:94813445-94813467 CCAACCATTCTCCTTTGCCCTGG + Intergenic
912665212 1:111572688-111572710 CCAACTATCATGGTTTTCTCAGG + Intronic
914334012 1:146698904-146698926 CCATCCACCATGGTTGACCCAGG - Intergenic
914347424 1:146811781-146811803 CTAACCATCCTGGTTTGCATAGG - Intergenic
915834431 1:159163877-159163899 CCAACCATCCCAGTTTGCTCAGG + Intergenic
916442744 1:164843471-164843493 CCATCCATCCCAGTTTGCCCAGG - Intronic
917560212 1:176143753-176143775 CCAACCATCCTGATTGGCCCAGG - Intronic
917595805 1:176528025-176528047 CCAACTGTCATGGTTTACCCAGG - Intronic
917803307 1:178590773-178590795 CTAACCATTCTAGTTTACCTAGG - Intergenic
917922742 1:179764624-179764646 ACAACCATCCTGGTTTGCCGAGG - Intronic
918518323 1:185386898-185386920 CCAACCATTCAGGTTTTCCTGGG + Intergenic
919140183 1:193560531-193560553 CCAGCCATGCTGGTTTTCCCAGG + Intergenic
920072206 1:203310391-203310413 CCAACAATCCTGCCTTAGCCTGG - Intergenic
920125936 1:203693799-203693821 CCAACCATCCCGGTTTGCCCGGG + Intronic
920249431 1:204613530-204613552 CCAACCATCCCAGTTTCCCCAGG + Intergenic
920259531 1:204679484-204679506 GCAACCAGCCTGGGTTCCCCAGG - Intronic
920452409 1:206069528-206069550 CCAACCATCCTGGTTGGCCTGGG + Intronic
921078546 1:211720305-211720327 CCAAACATCCTGGTCTGCTCAGG - Intergenic
921090848 1:211840879-211840901 CCAACCATCCCAGTTTGCCTAGG + Intergenic
921563242 1:216683902-216683924 CAAACCATCCTGGTTTACCTCGG - Intronic
921727718 1:218541985-218542007 ACAACCATCCTGATATACCTAGG - Intergenic
921754424 1:218837250-218837272 CCAACTGTCCTGGTTTCCCTAGG - Intergenic
922353644 1:224756262-224756284 CCAACCATCCCAGTTTGCCCAGG + Intergenic
922988809 1:229887318-229887340 ACAACCATCCCAGTTTGCCCAGG - Intergenic
923049767 1:230382623-230382645 CCAACCACCCTAGTTTACCTAGG - Intronic
923245860 1:232131363-232131385 CCAACTGTCCTGGTTTGCCTGGG - Intergenic
923333606 1:232947899-232947921 CCATTCATCCTGGTTTGCTCGGG + Intergenic
924574646 1:245268817-245268839 CCAAACATCCTGGTTTGCATGGG + Intronic
1064368637 10:14730829-14730851 CCAACTGTCCTGGTTTGCCCGGG - Intronic
1065861013 10:29872420-29872442 ACAACCATCCTGGTGTCCCTGGG + Intergenic
1067211638 10:44264557-44264579 CCATCCATCCTGCTTCACGCAGG - Intergenic
1068626950 10:59259846-59259868 CCAACCATCCCAGTTTGCCCAGG + Intronic
1069580158 10:69560201-69560223 CCAACCATCTGGGTTTGCCAGGG + Intergenic
1069866769 10:71508879-71508901 CCAACCATCCCAGTTTGCCTGGG + Intronic
1070263370 10:74879316-74879338 CCAACCATCCTGGTTTTCCTAGG - Intronic
1070274480 10:74992400-74992422 CCAACCATCATAGCTTAGCCTGG + Intronic
1070689317 10:78512828-78512850 TCAACCATCCCGGTTTTCCCAGG + Intergenic
1070848799 10:79546001-79546023 CCAACCTTCCTGGTTTGCCAGGG - Intergenic
1070924991 10:80214190-80214212 CCAACCTTCCTGGCTTGCCAGGG + Intergenic
1071991248 10:91102600-91102622 GAAACCATCCTGGATTACCCAGG + Intergenic
1072478969 10:95792230-95792252 CCAACCATCCCAGTTTGCCTGGG - Intronic
1072920493 10:99572954-99572976 CCAACCATCCCGCTTTACCCAGG + Intergenic
1073280860 10:102352949-102352971 CCAACCATCTTGGTTTGCCTGGG - Intronic
1073810367 10:107146004-107146026 GCAAGCATCCTGGTTTTCACAGG + Intronic
1074761036 10:116667720-116667742 CCAATCGTCCTGGTTTGCCAAGG + Intronic
1074766916 10:116706403-116706425 CCAACCCTCCCAGTTTGCCCAGG + Intronic
1074780426 10:116798283-116798305 CCAACTGTCTTGGTTTGCCCAGG + Intergenic
1075018053 10:118925494-118925516 CCAATCATCCAGGTTTGCCTGGG - Intergenic
1076167863 10:128296825-128296847 CCACCCCTCCTGGTTTATTCTGG - Intergenic
1076600814 10:131655759-131655781 CCAAGGATCCTGCTTTTCCCAGG - Intergenic
1077512022 11:2971701-2971723 TGAAACATCCAGGTTTACCCAGG - Intronic
1077527270 11:3074760-3074782 CCAGCCATCCTGGGTTGCCCAGG + Intergenic
1078473591 11:11611564-11611586 CCAACCATCCAGGCTTGCCCAGG + Intronic
1078668596 11:13345929-13345951 CCAACCATCCCGGTTTGTCTGGG + Intronic
1078752707 11:14180111-14180133 CCAACCATCCCAGTTTGTCCAGG + Intronic
1078907947 11:15704879-15704901 CCAATCTTCCTGACTTACCCAGG + Intergenic
1079194240 11:18311290-18311312 CCAACCATCCTGGTTTGCCTAGG - Intronic
1080675574 11:34423667-34423689 CCAACTATCCTGATTTGCCAGGG + Intergenic
1080675590 11:34423741-34423763 CCAACCATCCTGGTTTACCTGGG - Intergenic
1080697028 11:34611619-34611641 CCAACCTTCCTGGTTTGCCTGGG + Intergenic
1081073794 11:38642906-38642928 CCAAGCATCATGGCTTTCCCAGG + Intergenic
1081520803 11:43879325-43879347 CCAACCATCTCAGTTTGCCCAGG + Intergenic
1081595624 11:44457363-44457385 CCAACCATCTCAGTTTACCTGGG + Intergenic
1083520254 11:63303654-63303676 CCAGCCATCCTAGATTTCCCAGG - Intronic
1084930238 11:72549569-72549591 CCAACCATCCCAGTTTGCCCAGG + Intergenic
1087584340 11:100099243-100099265 CCAACTGTCCTAGTTTGCCCAGG + Intronic
1087666463 11:101054280-101054302 CCAAGAATCCTGGTTTACTCAGG + Intronic
1087995985 11:104809755-104809777 CCAACCATTCTGGTTTGCTGAGG + Intergenic
1088697464 11:112380587-112380609 CCAACCATCCCAGTTTACCTGGG - Intergenic
1088723618 11:112615717-112615739 CCAACCATCCCAGTTTGCCTAGG - Intergenic
1089338141 11:117739735-117739757 CAACTCATCCTGGTTTGCCCAGG - Intronic
1090402163 11:126455932-126455954 CCAGACATCCTGATCTACCCAGG + Intronic
1090883383 11:130854358-130854380 CCTACCATCCTGGTTTGCTTGGG + Intergenic
1091168838 11:133502884-133502906 CCAGCCATCCTGGTTTTCCTGGG + Intronic
1092218631 12:6698814-6698836 CCAACCATCCCGATTTTCCCAGG - Intronic
1092362029 12:7845197-7845219 CCAACCATAGAGGTTTGCCCAGG - Intronic
1092752512 12:11731978-11732000 CCAACCATGCTGGTTTGTCTGGG - Intronic
1093381985 12:18504147-18504169 CCAATCATCCCAGTTTACCCAGG - Intronic
1093998444 12:25668012-25668034 CCAACCATTCTGGTTTTCTTGGG - Intergenic
1094709186 12:32943938-32943960 CCAGCTATGCTGGTTTGCCCAGG + Intergenic
1096570118 12:52517992-52518014 CCAATCATCCCTGTTTCCCCAGG - Exonic
1096660049 12:53118631-53118653 CCCACTTTCCTGGTTTACCCAGG + Intronic
1096874356 12:54615621-54615643 CCAACCATCCTGATTTGCTATGG - Intergenic
1098242246 12:68480089-68480111 CCAACCATCCTGGTTTGCTGAGG - Intergenic
1098257471 12:68631914-68631936 CCAACCATTCTTGTTTTCCCAGG + Intronic
1099591840 12:84602238-84602260 CCAGTCATCCTAATTTACCCAGG - Intergenic
1100205841 12:92348465-92348487 CCATCCATCATGGTTTGCCTGGG - Intergenic
1100333749 12:93610313-93610335 CCAACCATCCAGGTTAGCCCGGG - Intergenic
1100568163 12:95818785-95818807 CCAACCATCCTGGTTTTCCCAGG + Intronic
1100644345 12:96513362-96513384 CCATCCGTCCTGGCTTGCCCAGG + Intronic
1101030671 12:100655700-100655722 CTAACCATCCCGGTTTGCCTAGG + Intergenic
1101129303 12:101672356-101672378 CCAAGCATCCAGGCGTACCCTGG - Intronic
1101566125 12:105907338-105907360 CCAACCATCTTGGTTTGCCCAGG - Intergenic
1101816063 12:108147112-108147134 CCCACCATCCAGGTTTGCCTGGG - Intronic
1101943412 12:109117707-109117729 CCAACCATCCCACTTTGCCCAGG + Intronic
1102796826 12:115696131-115696153 CCAGCCACCCTGGTTTCCCTAGG - Intergenic
1102875581 12:116446192-116446214 CCAACTATCCTAGTTTGCTCAGG - Intergenic
1103075590 12:117979933-117979955 CCAGTCATCCTGGTTTACCTGGG + Intergenic
1104155310 12:126125808-126125830 CCAACGGTCCCAGTTTACCCAGG + Intergenic
1106514351 13:30440191-30440213 CCAACCATCCTGGTTTGCCTAGG - Intergenic
1107212885 13:37878872-37878894 CCAACTGTCCTGATTTACCCAGG - Intergenic
1107402782 13:40085733-40085755 TCAACCATCCTGGTTTGCCCAGG - Intergenic
1107640520 13:42438671-42438693 ACAATTATCCTGGATTACCCAGG + Intergenic
1107807181 13:44164362-44164384 CCAATGATCCTGGCTTACTCAGG + Intergenic
1108707846 13:53006282-53006304 CCAACCATCCTGCCCTACCTGGG - Intergenic
1110617261 13:77554881-77554903 CCAGCCATCCAGGTTTGTCCAGG + Intronic
1111866040 13:93769972-93769994 CCAACCATTATGGTTTGCCAAGG + Intronic
1112140657 13:96638057-96638079 CCAACCACCTTGGTTTTACCTGG + Intronic
1112880287 13:104098675-104098697 CCAACCATTCTGGTTTGCCCAGG - Intergenic
1115187085 14:30701228-30701250 TCAGCCATTCTGCTTTACCCTGG + Intronic
1115328483 14:32168231-32168253 CCAACAGTCCCGGTTTACCTGGG - Intergenic
1115422031 14:33206351-33206373 CCAAGGATCCTGGTTTGCCCAGG + Intronic
1116076019 14:40112164-40112186 CCAAGGATGCTGGTTGACCCTGG - Intergenic
1117052988 14:51880741-51880763 CCAACTGTCCTGATTTGCCCCGG - Intronic
1117284311 14:54272071-54272093 CCCACCATCTTGGCTTCCCCAGG + Intergenic
1117573003 14:57067805-57067827 CCAACCATTCTTTTTTTCCCAGG + Intergenic
1117772781 14:59151557-59151579 CCAGCCATCCTTGTTTCTCCTGG + Intergenic
1118458037 14:65962525-65962547 TCAACCATTCTGGTTTGCCCAGG + Intronic
1118566145 14:67143051-67143073 CTAACTATCCTGGTTTGCCTAGG - Intronic
1119068120 14:71551335-71551357 CTAGCCATCCTGGTTTGCCTGGG - Intronic
1119496599 14:75084885-75084907 CCAACTATCCAGGTTTGTCCAGG + Intronic
1119668267 14:76499709-76499731 CCAACCGTCTTGGTTTGTCCAGG + Intronic
1119762089 14:77158828-77158850 CCAACCCTCCTGGATGGCCCAGG + Intronic
1119908360 14:78326020-78326042 CCAATCATCCTGGTTTGCCCAGG - Intronic
1120749773 14:88186725-88186747 CCACCCATCCCAGTTTTCCCAGG - Intronic
1120991464 14:90381206-90381228 CCAACTGTCCTGGTTTGCCTGGG + Intergenic
1121375446 14:93405931-93405953 CCAACTATCCTGGTTGGTCCAGG + Intronic
1121820547 14:96962331-96962353 CCAACCATTCTGGTTTGCCTTGG + Intergenic
1122364724 14:101187834-101187856 CCAACCATCCTGGCTTGCCTGGG - Intergenic
1124709301 15:31992287-31992309 CCAACAGTCTTGGTTTGCCCGGG + Intergenic
1125348550 15:38743675-38743697 CCAACCTTTGTGGTTTGCCCAGG - Intergenic
1125454653 15:39844859-39844881 CCAACCATCCTGGTTTGTCCAGG + Intronic
1126003559 15:44234563-44234585 TCAACCATCCTGGTTTTCCTGGG - Intergenic
1126058369 15:44754331-44754353 CTAACCATCCTGTGTTAGCCAGG + Intronic
1126170675 15:45692914-45692936 CCACACATCCTGGTTTGCCTGGG + Intergenic
1126684218 15:51233243-51233265 CCAACTATCCTGGTTTGCCCGGG + Intronic
1126785436 15:52174726-52174748 ACAACTATCCTGGTTTGCCTAGG + Intronic
1127292312 15:57581598-57581620 CCAACCATTCTGGTTTGCCTGGG + Intergenic
1127388473 15:58486359-58486381 CCAACCATCCTGGTTTGCATGGG - Intronic
1128310700 15:66630365-66630387 CCAACTATCCTGGTTTACCTGGG + Intronic
1129962555 15:79700728-79700750 CCAATCATCCTAGTTTTCCCAGG - Intergenic
1130047319 15:80455596-80455618 CCAACCATCCTGGTGTGTCCAGG + Intronic
1130122620 15:81064415-81064437 CCAAACATCCTGGTTTTCCTGGG + Intronic
1130378417 15:83351076-83351098 CCAATCATCTTAGTTTGCCCGGG + Intergenic
1130561949 15:84965747-84965769 CCAACTATCCTGGCTTGCCCAGG - Intergenic
1130666261 15:85872329-85872351 CCAACCATCCCAGTTTGCCTGGG - Intergenic
1131182547 15:90250370-90250392 CCAATCATCCAGGTTCACACTGG - Intronic
1132115842 15:99135968-99135990 CCAACTGTCCTGGTATGCCCAGG - Intergenic
1133038309 16:3046668-3046690 TCAACCATCCTGGGATTCCCGGG + Exonic
1133109168 16:3535444-3535466 CCAGCCATCCTGGTTTACATGGG + Intronic
1133364357 16:5198862-5198884 CCAACCATCCCAGCTTGCCCAGG - Intergenic
1133387119 16:5378628-5378650 CCAACCATCCCAGTTTACCCAGG - Intergenic
1133575566 16:7085878-7085900 CCAACCATCCTGGTTTGATGGGG - Intronic
1133650408 16:7807336-7807358 CAAACCATCCCAGTTTGCCCAGG + Intergenic
1134025180 16:10947651-10947673 CCAACCGTCCTGGTTTGCCTGGG + Intronic
1134084746 16:11348729-11348751 CCAACCCTCCTGGGTTGCCTGGG + Intronic
1134273723 16:12757265-12757287 CCAACCAGCCTGGTTTGCCCAGG - Intronic
1134591254 16:15455397-15455419 CCAGCCATCCTGGTTTGCCTGGG + Intronic
1134810709 16:17164848-17164870 TCAACTGTCCTGGTTTGCCCAGG + Intronic
1135269077 16:21053515-21053537 CCAACCACACTGGGGTACCCTGG + Intronic
1136532541 16:30879189-30879211 CCAAGCATCCCTGTTTGCCCAGG - Intronic
1137775453 16:51050550-51050572 CCAACTCTCCTGGTTTTCCCAGG + Intergenic
1137965927 16:52933512-52933534 CCAACCATCATTGTATACACTGG + Intergenic
1138161324 16:54757562-54757584 CCAACCATCCTGGTTTGCCTGGG - Intergenic
1138823553 16:60290512-60290534 CCAATCATTCTGGTTTGCCTGGG - Intergenic
1139801381 16:69525823-69525845 CCAACCATCCCGGTTTGTCCAGG + Intergenic
1139986563 16:70903464-70903486 CTAACCATCCTGGTTTGCATAGG + Intronic
1140983497 16:80134976-80134998 CCAATCATCCTGTTTTACCCAGG - Intergenic
1141426560 16:83947974-83947996 CCAACTGTCTTGGCTTACCCAGG + Intronic
1141469043 16:84226082-84226104 CCAACCATCCCGGTGTGCCCAGG - Intronic
1142779925 17:2173628-2173650 CCAGCCATCCCAGTTTGCCCAGG - Intronic
1143282144 17:5762896-5762918 CCAACCATCCTAATTTCCCTGGG + Intergenic
1143314384 17:6021039-6021061 CCAACCATCCTGTTTTGTCTGGG - Intronic
1143970178 17:10789689-10789711 CCAGCCAGCCTGGTTTGCCCAGG + Intergenic
1144038300 17:11386856-11386878 CCGACCATCCCGGGTTGCCCAGG + Intronic
1144142705 17:12365027-12365049 CCAACTATCCTGGTTTTCCCAGG - Intergenic
1145901109 17:28491099-28491121 CCAAGCATCTTGGTTTGCCCAGG - Intronic
1147120492 17:38332580-38332602 CCAACCATCCTGCTTTGCTGGGG + Intronic
1147256469 17:39185012-39185034 CCACCCTTCCTGGTTCTCCCTGG - Intronic
1147493343 17:40892647-40892669 CCAACTGTCCTGGTTTGCCCAGG + Intergenic
1147733651 17:42619952-42619974 CCAACTGTCCTGGTTTTCCTAGG - Intergenic
1147847451 17:43414516-43414538 CAAACTGTCCTGGTTTGCCCAGG - Intergenic
1147854007 17:43464738-43464760 CCAACCATCTTGGGTTGCCTAGG - Intergenic
1148050116 17:44765914-44765936 CCAACAATTCTGTTTTACCGAGG + Intronic
1148844825 17:50523469-50523491 CCAACCATCCCAGTTTGCCCAGG - Intronic
1149561873 17:57613333-57613355 CCCATCATCCTGGTTTGCCTGGG + Intronic
1149579769 17:57741491-57741513 CCAACCATCCTTGCTTTCCCAGG + Intergenic
1150680592 17:67281273-67281295 CCAGCCTTCCTGGCTTCCCCAGG + Intergenic
1151227443 17:72657596-72657618 CCAACCATTCCGGTTCACCAGGG + Intronic
1152179230 17:78807446-78807468 CCAACCATCCTAGACGACCCTGG - Exonic
1152202633 17:78956063-78956085 CCAACCCTCCCAGTTTGCCCAGG + Intergenic
1152332427 17:79680950-79680972 GCCACCATCCCAGTTTACCCAGG + Intergenic
1153939586 18:9966751-9966773 CCAAACATCATGGCTTAGCCTGG - Intergenic
1155077183 18:22369267-22369289 ACAACCATCCTGGTCTGCCCGGG - Intergenic
1155157976 18:23173377-23173399 CCAACCATCCAGCTCTTCCCTGG + Intronic
1156125494 18:33899741-33899763 CCAGCCATTTTGTTTTACCCTGG + Intronic
1156568406 18:38222553-38222575 CCAATAATCCTAGTTTTCCCAGG + Intergenic
1157433880 18:47652569-47652591 CCAGCTGTCCTGGTTTGCCCAGG + Intergenic
1157470521 18:47984591-47984613 CCAGCCATCCAGGTTTGCCTGGG - Intergenic
1158159780 18:54468133-54468155 CAAACCATCCTTGTTTGCCTGGG + Intergenic
1158333065 18:56384241-56384263 CCAACTATGCTAGTTTGCCCAGG + Intergenic
1158400180 18:57114809-57114831 CTGACCTTCCTGATTTACCCTGG + Intergenic
1158854300 18:61527521-61527543 CCAACCGTCCTGGTTTGCCTGGG + Intronic
1159061013 18:63513924-63513946 CCACCCATCCTGGCTTCCCTGGG - Intergenic
1159107908 18:64025256-64025278 CAAACCAACATGGTTTACTCTGG + Intergenic
1159204298 18:65230678-65230700 TCAACCATCCCAGTTTGCCCAGG + Intergenic
1159548389 18:69869737-69869759 CCAGCCATTCTGGTTTGCCTGGG + Intronic
1159888847 18:73935939-73935961 CCAACCAACCTGGCTCACTCAGG + Intergenic
1161138932 19:2636726-2636748 CCAACCATCTGGGTTTGCCTGGG + Intronic
1162531742 19:11240002-11240024 CCAACCATCCTGGTTTGCCCAGG + Intronic
1163043005 19:14616497-14616519 CAATTCATTCTGGTTTACCCGGG - Intergenic
1164759368 19:30717369-30717391 TCAACCATCCTGGTTTCCCTGGG + Intergenic
1164911997 19:32020409-32020431 CCAGCCATCCTGGTTTTCCTGGG + Intergenic
1165485097 19:36090645-36090667 GCAAGCATCCTTGTTTAACCAGG - Intronic
1165794463 19:38510912-38510934 CCAGCCATCCTAGTGTACCCGGG + Intronic
1165941297 19:39415947-39415969 CCAACCATCCTGGTTTGTCCGGG - Intronic
1167324631 19:48816491-48816513 CCAGCCATCCCAGTTTGCCCAGG + Intronic
1168246310 19:55114539-55114561 CCAACCATCCCTGTTTTCCTAGG + Intronic
1168508476 19:56955677-56955699 CCAACCATCCTGGTTTGCCCGGG - Intergenic
925609531 2:5692076-5692098 CGAACCATCCCGGTTCGCCCCGG + Intergenic
926913571 2:17873184-17873206 CCAACTGTCCTGGTTTGCCCTGG + Intergenic
927507683 2:23625108-23625130 CCAACCAGCCTGGATGACCACGG - Intronic
927813835 2:26196603-26196625 CCAACCATCTTGGTTTGCCCGGG - Intronic
928142306 2:28740355-28740377 CCAATGATTCTGGTTTACCCAGG + Intergenic
928261092 2:29767456-29767478 CCAGCCATCCTGGTTTTCCAGGG - Intronic
928455377 2:31416120-31416142 CCAACCATCCCAGTTTGCCCTGG - Intergenic
929379391 2:41332668-41332690 CCAACCATTCTGGTTTGCCTAGG + Intergenic
931122717 2:59238024-59238046 CCATTCTTCATGGTTTACCCTGG + Intergenic
931383216 2:61773030-61773052 CCACCCATCGTGGTTTGCCTGGG + Intergenic
932009489 2:67960796-67960818 CCAACTATCCTAGTTTTCTCAGG - Intergenic
932055468 2:68438813-68438835 CCAACCATCCTGGTTTGCCTGGG - Intergenic
932113748 2:69025769-69025791 CCAAACATCCTAATTTGCCCAGG + Intronic
932582456 2:73000636-73000658 CTGACCGTCCTGGTTTGCCCAGG + Intronic
932816183 2:74864060-74864082 CCAACCATCCCAGTTTGCCCAGG - Intronic
932844155 2:75117692-75117714 CCAAACATCCTAGTTTAGCCTGG + Intronic
933394779 2:81717331-81717353 CAAACCATCCTAGTTTGCCTGGG + Intergenic
933980192 2:87543009-87543031 GCAACCATCCTAGTTTCCCCAGG - Intergenic
934045930 2:88172425-88172447 CCAACCATCTTAGTTTGCCTGGG + Exonic
935827404 2:106965200-106965222 CCAACCACCCTGGGTTGCCTGGG - Intergenic
936313634 2:111407782-111407804 GCAACCATCCTAGTTTCCCCAGG + Intergenic
937198892 2:120184154-120184176 CCAATCATCCTGGTTTCCCCTGG + Intergenic
937301770 2:120847110-120847132 CCAATCATCCGGGTTTGCCTGGG + Intronic
939857997 2:147383505-147383527 CCAACCATCCTGGTTTACCTGGG - Intergenic
940276552 2:151946366-151946388 CCAACCTTCCTGGTTTGCCTGGG + Intronic
940576654 2:155515591-155515613 CCAACTATCCTGGTTTGTCTGGG + Intergenic
940861651 2:158776531-158776553 CCAACCATCCCAGTTTGCACAGG - Intergenic
941466018 2:165828282-165828304 CCAACCATTCTGGTTTGCCCAGG - Intergenic
942567600 2:177282040-177282062 CCAACCATCCCAGTTTGCCTGGG - Intronic
942956725 2:181782024-181782046 CCATTCATCTTGGTTTGCCCAGG - Intergenic
943062824 2:183056621-183056643 CTAAGCATCCGGGTTTAACCTGG + Intergenic
943464512 2:188212220-188212242 CCCACCATCTTGCATTACCCTGG - Intergenic
943567715 2:189535967-189535989 CCAACCCTTCTGCTGTACCCTGG + Intergenic
944221089 2:197305010-197305032 CCACATATCCAGGTTTACCCAGG + Intronic
944384777 2:199151907-199151929 CCATCCTGCCTGGTTTTCCCAGG + Intergenic
944657592 2:201891517-201891539 CCAACCATCCTGGTTTACCCAGG - Intronic
946732728 2:222724741-222724763 CCAACCATCCTACTTTCCCTGGG - Intergenic
947068787 2:226262422-226262444 TCAATCATCCTGGTTTGTCCAGG + Intergenic
948376824 2:237526119-237526141 CCAACCATCCTGGTCTGGGCAGG + Intronic
948524233 2:238560384-238560406 CCAGCCATCCTGGTGTCTCCTGG - Intergenic
948579266 2:238972980-238973002 CCAACTGTCCTGGTTTGCCTGGG - Intergenic
1168858839 20:1030172-1030194 CCAACTGCCCTGGTTTACCTGGG - Intergenic
1169547896 20:6669655-6669677 CCAAACACCCTGGTTTTCCTGGG + Intergenic
1169842887 20:9959644-9959666 CCAAACATCATGGTTTGCCCTGG + Intergenic
1170438687 20:16355981-16356003 CCAACTGTCCTGGTTTGCTCAGG + Intronic
1170547387 20:17446004-17446026 CCAACTGTCTTGGTTTGCCCAGG - Intronic
1170690892 20:18614253-18614275 CCAGCCATCCTAGTTTGCCCAGG - Intronic
1170857467 20:20070393-20070415 CCATTCATCCTAGTTTGCCCAGG + Intronic
1170885185 20:20334447-20334469 CCAATGATCCTGGTTTACCTGGG - Intronic
1171110760 20:22480036-22480058 ACAACCATCTTGATTTACCCAGG + Intergenic
1171211455 20:23320369-23320391 CCAAGCATCCTGGTTCTCCACGG + Intergenic
1171417244 20:24991404-24991426 CCAACCATCCTGCGTTGCCCTGG - Intronic
1172128035 20:32636822-32636844 CCATTCATCCTGGTCTGCCCAGG + Intergenic
1172176056 20:32972597-32972619 CCAGCCATTCTGGTTTGCCCAGG - Intergenic
1173502034 20:43561021-43561043 CTAACCATCCTGGTTGGCCCAGG + Intronic
1173674765 20:44824119-44824141 ACAGCCATCCTGGTTTTTCCAGG - Intergenic
1174262385 20:49305972-49305994 CAAACCATCCTAATTTGCCCAGG - Intergenic
1174299895 20:49573956-49573978 CCAACCTTCCTGGTTTACCCAGG - Intergenic
1174324797 20:49770670-49770692 TCAACCATCCTGATTTGCCTGGG + Intergenic
1174374199 20:50114623-50114645 CCAGGCATCCTGCTTTGCCCTGG - Intronic
1174501894 20:50991234-50991256 CCAATCATCCTGGTTTGCACAGG + Intergenic
1174501899 20:50991283-50991305 CCAACCATTCTGGTTTTCCCAGG - Intergenic
1174553406 20:51377615-51377637 GAAACCATCCTGGATTAACCAGG + Intergenic
1174580000 20:51564549-51564571 CCAACCTTCCTGGTTTGCCTGGG + Intergenic
1174664006 20:52240299-52240321 CCAACCATTCTGGTTTGCCCAGG - Intergenic
1174766990 20:53263916-53263938 CCAATCATTCAGGCTTACCCAGG + Intronic
1174779541 20:53376231-53376253 CCAACTGTCCTGGTTTGCTCTGG + Intronic
1174787189 20:53444034-53444056 CCAGCCATCATCGTTTTCCCGGG + Intronic
1175167448 20:57054793-57054815 CCAACCGTCCTCGTTTGCCTGGG + Intergenic
1175290628 20:57872833-57872855 CCCACCATCTTGGCTTACCTGGG - Intergenic
1175475712 20:59272671-59272693 CCAATCATCCTGGTTTGCCTGGG - Intergenic
1175505634 20:59482417-59482439 CCAGCCATGCTGGTTTGCCCAGG - Intergenic
1176253733 20:64139750-64139772 TCCACCGTCCTGGTTTGCCCAGG + Intergenic
1176886345 21:14259952-14259974 CCAACCATCCTTTTTTGCCTTGG + Intergenic
1176989986 21:15483966-15483988 CCAACCGTCTTGGTTTTCTCAGG + Intergenic
1178058476 21:28825766-28825788 CCAACTATTCTAGTTTTCCCAGG + Intergenic
1178209985 21:30519055-30519077 CCAGCCATCCTGGTTTTGCTGGG + Intergenic
1178531959 21:33383198-33383220 TGACTCATCCTGGTTTACCCTGG + Intergenic
1178697719 21:34808523-34808545 CCAACCCTGCTGGTTCACCCTGG + Intronic
1178734104 21:35133422-35133444 CCAACCATCTTGGTTTGCCCAGG + Intronic
1181321553 22:22010890-22010912 CCAGCTGTCCTGGTTTGCCCGGG - Intergenic
1181873690 22:25923337-25923359 CCAGCCATCCTGGCTTGCCCAGG - Intronic
1181995576 22:26878966-26878988 CCAACCATGCTAGTTTGCCTGGG + Intergenic
1182130152 22:27844743-27844765 CCAGCCATTCTGGTTTGCCCAGG - Intergenic
1183028617 22:35085268-35085290 CCAACCATCCAGGTTTGCATGGG + Intronic
1183857579 22:40646063-40646085 CCAAGCTTCCTAGTTTCCCCTGG - Intergenic
1184427929 22:44423950-44423972 CCATCCATGCTTGTTGACCCTGG + Intergenic
949413849 3:3796056-3796078 CCAACCATCTTAGTTTGCCTGGG - Intronic
950120889 3:10481970-10481992 CCAACTGTCCTGGTTTGCCTCGG + Intronic
950148980 3:10671505-10671527 CCAACCATCCTGGTTTGTCCAGG - Intronic
950270975 3:11614601-11614623 CCAGCCATCCAGGTTTCCCACGG + Intronic
950391338 3:12699080-12699102 CCAACCATCCCAGTTTGCCCAGG - Intergenic
951475535 3:23101948-23101970 CCAACCATCTTGGCTTGCCTGGG + Intergenic
951918053 3:27822538-27822560 CCAACTGTCCTGGTTTGCCCTGG + Intergenic
953036719 3:39217979-39218001 TCAATAATCCTGGTTTGCCCAGG - Intergenic
953290993 3:41662593-41662615 CCAACCATCTTGATTTCCTCTGG - Intronic
953405531 3:42657927-42657949 CCAACCATCCAGGTTTGCCAGGG - Intronic
954448126 3:50557518-50557540 CCAGCCATCCTGGTTTTCCCAGG - Intergenic
955212707 3:56956670-56956692 CCAACCATCCAAGTTTGCCCAGG - Intronic
955795452 3:62632015-62632037 CAAATCATTCTAGTTTACCCAGG - Intronic
955999239 3:64711106-64711128 CCAACCATCCTAGTTTGCCTGGG - Intergenic
956108799 3:65850413-65850435 CTAGCCATCCTGGTTTACCCTGG - Intronic
956191692 3:66614198-66614220 TAAACTATCCTGGTTTGCCCAGG + Intergenic
957329245 3:78738688-78738710 CCAACCATTCTGGTTTGCCCAGG - Intronic
957345697 3:78958781-78958803 CCAAGCATCCTGGTTTACCTGGG - Intronic
957346795 3:78971584-78971606 CCAACCATACTGCTCAACCCAGG + Intronic
958702041 3:97604333-97604355 CCAATCATCCTAGTTTGCCTGGG + Intronic
959510955 3:107211632-107211654 CCAACCCTCTTAGTTTTCCCAGG + Intergenic
960646499 3:119890508-119890530 CCAACCATCCCAGTTTGCCTGGG + Intronic
960647646 3:119906524-119906546 GTATACATCCTGGTTTACCCAGG + Intronic
961033017 3:123623025-123623047 CCAGCCATCCTGGCTTGCCCAGG + Intronic
962036031 3:131652807-131652829 CCAACTGTCCTGGTTCACCCAGG + Intronic
962218264 3:133541458-133541480 CCAACCATCCTGGTTTGTCCAGG - Intergenic
962464167 3:135641307-135641329 TCAACCATCTTGGTTTGCCTGGG - Intergenic
962580624 3:136794830-136794852 CCAACCATCCTGATCGACCTGGG + Intergenic
962704605 3:138030825-138030847 CTAACTATCCTGGTTTGCCCCGG + Intronic
962705350 3:138038184-138038206 CCAACCATCCCAGTTTGTCCAGG + Intergenic
962748082 3:138412314-138412336 CCAATGGTCCTGGTTTGCCCGGG - Intergenic
962871601 3:139499718-139499740 CCAACTATCCTGGTTTCTCTAGG - Intergenic
962957165 3:140276737-140276759 CCAACCATACTAGTTTTCCAAGG - Intronic
963005548 3:140723468-140723490 CCAACCATCTTGATTTGCTCAGG - Intergenic
963271527 3:143290240-143290262 CCACACATCCTGGTTTGCCTTGG - Intronic
963273467 3:143307949-143307971 TCAACCATCCAGGTTTTTCCAGG - Intronic
963784208 3:149516269-149516291 ACAACTCTCCTGGTTTGCCCAGG - Intergenic
963787685 3:149551617-149551639 CCAATTATCCTGGTTTGCCTGGG + Intronic
963989807 3:151639968-151639990 TTAATCATCCTGGTTTTCCCAGG - Intergenic
964030620 3:152135008-152135030 CCATCCCTCCTGGTTTTCCCAGG - Intergenic
964574694 3:158152294-158152316 CCAACCATCTTGGCTTGCCGGGG + Intronic
965396182 3:168162671-168162693 CCAACCATCTGGGTTTGCCCAGG - Intergenic
965680426 3:171245517-171245539 CCAACCTTCCTGGGTAACTCTGG - Intronic
965880467 3:173382514-173382536 CCAACCAGCTTTGTTTACACTGG - Intergenic
966297912 3:178445196-178445218 CCAACCATCCTGGTTTGCCTAGG + Intronic
969040152 4:4289786-4289808 CCAATCGTCCTGGTTTGGCCAGG + Intronic
969232739 4:5842946-5842968 CAAACCATCTTGTTTTCCCCGGG - Intronic
969844466 4:9909333-9909355 CCACACATCCTGGTTTTCCCAGG - Intronic
970568857 4:17359776-17359798 TCAACTGTCCTGGTTTTCCCAGG + Intergenic
970882797 4:20951231-20951253 CCAACCATGCTGGTACCCCCTGG + Intronic
971325124 4:25637316-25637338 CCACCCATCCAGGTTTGCCAAGG + Intergenic
972731998 4:41803772-41803794 TCAACCATGCTGGTTTGCCCAGG - Intergenic
974020637 4:56688967-56688989 CCAAGCATTTGGGTTTACCCAGG - Intergenic
976051317 4:81014298-81014320 CCAACTATCCTGGTTTGCCCAGG + Intergenic
976315081 4:83651472-83651494 CCACTCATCCTGGTTTGCCAGGG - Intergenic
978495835 4:109358302-109358324 TTAACCACCCTGGTTTGCCCAGG - Intergenic
979207536 4:118057889-118057911 CCAACCGTCCTGGTTTGTCCAGG + Intronic
979447028 4:120825947-120825969 CCAACTATCCTAGTTTGCCCAGG - Intronic
979783142 4:124681412-124681434 CAATCCATCCTGGTTTGCCTGGG + Intronic
979786403 4:124720238-124720260 CCAACCCTCCTGGTAAAACCAGG - Intergenic
980078387 4:128318460-128318482 CCAACCATCCCAGTTTGCCTGGG + Intergenic
983511434 4:168613179-168613201 CCAACCATCCTGATTTGCCTCGG + Intronic
984000645 4:174237797-174237819 ATAACCATCCTGGTTTGCTCAGG - Intronic
984882069 4:184418840-184418862 CCAATCGTCCTGGTGTACCTGGG + Intronic
985819997 5:2153247-2153269 CCCACCATCCTGGGCTCCCCAGG - Intergenic
986654726 5:9999792-9999814 CCTGCCATCCTGGTGTTCCCAGG - Intergenic
987181923 5:15376924-15376946 CAAACTAGCCTGGTTTTCCCAGG + Intergenic
987287192 5:16468008-16468030 CTAGACATCCTGGTTTGCCCAGG - Intergenic
988490411 5:31700829-31700851 CCAAGTCTCCTGGTCTACCCAGG - Intronic
989719704 5:44510241-44510263 CCTAGCATCCTGGTTTTCTCTGG - Intergenic
990561477 5:56987845-56987867 CCAATCCTCCTTGTTTGCCCAGG + Intergenic
990636237 5:57731029-57731051 CCAACCATGCTGGCTTGCCTGGG + Intergenic
990709810 5:58567735-58567757 CCAATTATCTTGGTTTAACCAGG - Intergenic
991302044 5:65138308-65138330 CCAACTATACTGCCTTACCCTGG - Intergenic
991978859 5:72211060-72211082 CCAACTATCTTGGTTTGCTCAGG + Intergenic
992071621 5:73154156-73154178 CCAAGCATCCTGGTTTGCCTTGG - Intergenic
992159091 5:73983239-73983261 CCAGCCACCCTGGTTTGCCTGGG - Intergenic
993486822 5:88497087-88497109 TCAAACATCCTGGTTTACCTGGG + Intergenic
993707257 5:91185083-91185105 CCACACGTCCTGTTTTACCCTGG - Intergenic
994243516 5:97451481-97451503 CCAACCATCATGGTTTGCCCTGG + Intergenic
995078384 5:108015660-108015682 ACAAGCATTCTGGGTTACCCCGG - Intronic
995095072 5:108226199-108226221 CCAACCATTCTGATTTGCCTCGG + Intronic
997893362 5:137694697-137694719 CCAATCATGCTGATTTACCTGGG + Intronic
997931821 5:138078651-138078673 TCCAGCATCCTGGTTTGCCCAGG - Intergenic
998065669 5:139156314-139156336 CCTACCATACTGGGTTACCTTGG - Intronic
998965218 5:147532335-147532357 CCAACCATTCTGATTTCCCTTGG - Intergenic
999322773 5:150625306-150625328 CCAACCCGCCTGGGTTATCCTGG - Intronic
999652815 5:153784172-153784194 TCAACCACCCTGGTTTGCTCAGG + Intronic
999660404 5:153856613-153856635 CCCACCATCCTGGGTTTCCCTGG - Intergenic
1000142240 5:158416826-158416848 CCAACCATAGTGGTTTCCCTGGG - Intergenic
1001264179 5:170260564-170260586 TCAACTATCCTGGTTTTCCTAGG + Intronic
1001449509 5:171813471-171813493 CCAATCGTCTTGGTTTGCCCAGG - Intergenic
1001862479 5:175069657-175069679 CCAACCATCCTGGTTTTCCTGGG + Intergenic
1002360105 5:178663667-178663689 CCAGCCATCCTGGTTTGCCTGGG - Intergenic
1003534268 6:6962573-6962595 CCAACCATCCTGGCTTGCCTGGG + Intergenic
1003682262 6:8267705-8267727 CAAAGCATCCTGGTTTGCCCCGG - Intergenic
1004023748 6:11799019-11799041 TCAACCATCCCGGTTTACCCAGG + Intronic
1004892317 6:20113159-20113181 CCAAGCAGCCTGGACTACCCTGG + Intronic
1005122463 6:22404690-22404712 CCAATCGTCCTGGTTTGCCTGGG + Intergenic
1005145963 6:22690467-22690489 CCAACCATCCTGATTTGTCTGGG + Intergenic
1005806316 6:29477107-29477129 CCAACCAGCTTGGTTTTCCCAGG - Intergenic
1006400652 6:33815277-33815299 GCACACATCCTGGTTGACCCTGG + Intergenic
1006922206 6:37634333-37634355 CCAGCCAGCCTGGTCTCCCCTGG + Exonic
1007506869 6:42342296-42342318 CCAACCACCCTAGTTTGCCTAGG - Intronic
1007529634 6:42530284-42530306 CAATGCATCCTGGTTTGCCCAGG - Intergenic
1007990026 6:46245475-46245497 CCAACTGTCCTGGTTTCTCCAGG - Intronic
1008845939 6:55964225-55964247 CCAACCATACCAGTTTACCTGGG - Intergenic
1008970903 6:57366719-57366741 CCAACCATCCCAGTTTGTCCAGG - Intronic
1009033968 6:58093876-58093898 CCTACCAGCCTGGATTACACAGG + Intergenic
1009209580 6:60845583-60845605 CCTACCAGCCTGGATTACACAGG + Intergenic
1009944431 6:70326167-70326189 CCAACCATCCCAGTTTACCTAGG - Intergenic
1010966506 6:82215232-82215254 TCATCCATCCTGGTTTGCCCAGG - Intronic
1013843169 6:114422007-114422029 CCAACCATCCCAGTTTGCCCGGG + Intergenic
1013995019 6:116297917-116297939 CTAACCATCATGGTTTGCCTGGG + Intronic
1014281702 6:119448929-119448951 CCAACTGTCCTGGTTTGCCCAGG - Intergenic
1014983525 6:127974561-127974583 CCCACCATCCTGGTTTGCCCAGG - Intronic
1015090554 6:129352211-129352233 CCATACATTCTGGTTTGCCCAGG - Intronic
1015106452 6:129542406-129542428 CCAACCACCCTGGTTTGCCCAGG + Intergenic
1015195963 6:130524918-130524940 CCAACCATCTAGGTTTGCCTGGG + Intergenic
1015250713 6:131124710-131124732 CCAGCTGTCCTGGTTTGCCCAGG - Intergenic
1015529543 6:134207629-134207651 CCAACTGTCCCGGTTTGCCCAGG - Intronic
1016673804 6:146739434-146739456 CCATCTATCCTGGTTTGCCTGGG - Intronic
1017061663 6:150490664-150490686 CCAACTATGCTGGTTTTTCCAGG - Intergenic
1017201966 6:151764115-151764137 CCAACCGGCCTGGTTTGCTCGGG + Intronic
1017878618 6:158544350-158544372 CCAACCATCCTGATTTTTCTGGG - Intronic
1017879268 6:158548434-158548456 CCAACGATCCTGGTTTGTCTGGG + Intronic
1017903719 6:158740555-158740577 CCAACCATCCCAGTTTACTCAGG + Intronic
1017980341 6:159395613-159395635 CCAAGCACCCTGGTTTGCCCAGG + Intergenic
1018099088 6:160420621-160420643 CCAACTGTCCTTGTTTGCCCAGG + Intronic
1018497946 6:164369411-164369433 TCAACCATCCCGGTTTTCCCAGG + Intergenic
1019861579 7:3663671-3663693 CCAGCCATCTCGGTTTGCCCAGG - Intronic
1019891515 7:3950952-3950974 CCAACCATTGTGGTTCCCCCGGG + Exonic
1021055089 7:16037000-16037022 CCAACTGTCCTGGTTTGCCAAGG + Intergenic
1021397843 7:20172306-20172328 CCAGCCATCCTGGTTTGCTCCGG - Intronic
1021800388 7:24299526-24299548 CCAACCATTCTGGTTGTCCCAGG + Intergenic
1022519673 7:30998119-30998141 CCCAACATCCTGATTTACCAAGG - Intergenic
1022668162 7:32430394-32430416 CCTACCACCCTGGCTAACCCAGG + Intergenic
1023475968 7:40578268-40578290 CCAGTCTTCCTGGTTTTCCCAGG - Intronic
1023599818 7:41870716-41870738 CCAACTATCCTGGTTTACCAGGG - Intergenic
1023895037 7:44426279-44426301 CCAACCATTCTCCTTTCCCCAGG - Intronic
1025101266 7:56136971-56136993 TCAACCATCCCAGTTTGCCCAGG - Intergenic
1026318099 7:69245143-69245165 CCAACCATCCCAATTTGCCCAGG + Intergenic
1028224486 7:88233945-88233967 CCAACCATCCTGGTTTGCCCAGG - Intergenic
1028477975 7:91272444-91272466 CCAACTGTCCAGGTTTGCCCAGG + Intergenic
1028603725 7:92631277-92631299 CCAACCATCCCAGTTTGCCTGGG - Intronic
1030888856 7:114972418-114972440 CCAACAATCCCAGTTTACTCAGG - Intronic
1031114959 7:117657657-117657679 ACATACATCCTGGTTTGCCCCGG - Intronic
1031843206 7:126772227-126772249 GCAACCATCCTGGTTTTCCGGGG - Intronic
1032406393 7:131658979-131659001 CCAACAGTCCTGGTTTGTCCAGG + Intergenic
1032460478 7:132106527-132106549 CCAAACATTCTGGTTTGCCTTGG + Intergenic
1033628408 7:143133256-143133278 CTAACCATCTCAGTTTACCCAGG - Intronic
1034387094 7:150749018-150749040 CCAACCATCCTGGTTGGCCCAGG + Intronic
1034409172 7:150929976-150929998 CCAACCATTCTGGTTTGCTCAGG + Intergenic
1034849382 7:154479808-154479830 CCAATCATCCTGGGCTCCCCTGG + Intronic
1035921999 8:3687195-3687217 CCTTCCATCTTGGTTTGCCCAGG + Intronic
1036519188 8:9474676-9474698 CCAACCAACCTGGTTTACCTGGG + Intergenic
1036980434 8:13464087-13464109 ACAACCCTGCTGGTTTCCCCCGG - Intronic
1037345078 8:17890296-17890318 CCAAATATCCCGGTTTGCCCAGG - Intronic
1037354263 8:18000141-18000163 AGAACAATCCTGGTTTACACTGG - Intronic
1038545487 8:28422998-28423020 CCAAGCATCCTGGTTTGCCAGGG - Intronic
1038854871 8:31320223-31320245 CCAACTACCCTGGTTTTCCTGGG + Intergenic
1039731448 8:40282897-40282919 CTAACCATCCCAGTTTTCCCAGG - Intergenic
1039770354 8:40680286-40680308 CCAACCATCCTAGCTTTCCTGGG + Intronic
1042715337 8:71766017-71766039 CCAACCTTTCAGGTTTACTCAGG - Intergenic
1042777402 8:72448684-72448706 CCAACCATTCTGGTTTGCTCAGG + Intergenic
1043228964 8:77773955-77773977 CCAAGCATGCTGCTTTAGCCAGG - Intergenic
1043835197 8:85037323-85037345 CCAATCATCCCTGTTTGCCCTGG - Intergenic
1044050854 8:87502044-87502066 CCAACCATCTTGGTTTGTGCGGG + Intronic
1044270947 8:90243014-90243036 CCAACCATCCCAGTTTGCCCAGG + Intergenic
1045560290 8:103255285-103255307 CCAAACATCCTGGTTTGTCTGGG - Intergenic
1045681485 8:104665560-104665582 CCAACCATCCTGGTTTGCCTGGG - Intronic
1046482838 8:114845573-114845595 CCAATCATCCTGGTTTTCCTGGG + Intergenic
1046804585 8:118465776-118465798 CCATCCATCCTGGCTTACACAGG + Intronic
1047442128 8:124887637-124887659 CCAACCATTCTGGTTTTCCCAGG - Intergenic
1047712604 8:127567456-127567478 CCAACCATCCCAGTTTTCCCAGG - Intergenic
1047857771 8:128931138-128931160 CCATTCATCTTGGTTTGCCCAGG - Intergenic
1048048264 8:130793287-130793309 CCAACCATCTCGGTTCACCCAGG + Intronic
1048469904 8:134696568-134696590 CCTACCATCCTAGTTATCCCTGG + Intronic
1048509145 8:135046709-135046731 ATAACCATCCTGGTTTGCCTGGG + Intergenic
1048986172 8:139736256-139736278 CCAACTATCCCAGTTTGCCCAGG + Intronic
1050008573 9:1160997-1161019 CCAACCATCCTGGTTTTCCATGG + Intergenic
1052723989 9:32207248-32207270 CCATCCATCAGGGTTTAGCCTGG + Intergenic
1053267395 9:36725105-36725127 CCAACCATCTCGGTTTGCCCTGG - Intergenic
1054707087 9:68473702-68473724 CCAACAATCCTGGTTTGTCCAGG + Intronic
1055092932 9:72381057-72381079 CCAACCATTTTGGTTTGCCTGGG - Intergenic
1055257887 9:74393994-74394016 CCAACCATCCTGATTTGCTTAGG - Intergenic
1056178555 9:84059891-84059913 TCAACCATCCTGCTGTGCCCCGG + Intergenic
1056224006 9:84477701-84477723 CCAACCAGCCAGCTTTCCCCTGG + Intergenic
1057147360 9:92767383-92767405 CCAACCTTCCTGGCTTACCTGGG + Intergenic
1057898021 9:98925111-98925133 CCAACCATCCTGGTTTGCCCAGG - Intergenic
1057945453 9:99324152-99324174 CCAGCCATCCTGGTTTGCCTGGG + Intergenic
1058651642 9:107180349-107180371 CCAAATGTCCTGGTTTTCCCAGG - Intergenic
1058717680 9:107737522-107737544 CCACCCAGCTTGGTTTTCCCTGG - Intergenic
1058810881 9:108637762-108637784 CCAACAGTCCTGGTTTGCCAGGG + Intergenic
1059313143 9:113401981-113402003 CCAATCCTACTGGTTTACCCAGG - Intergenic
1059373589 9:113863668-113863690 CCAGGCATCCTAGTTTGCCCTGG - Intergenic
1059531154 9:115036826-115036848 CCAACCATCCTGGTTTGCCAGGG + Intronic
1060259756 9:122063812-122063834 CCAGCTGTCCTGGTTTGCCCAGG - Intronic
1062137377 9:134936700-134936722 CCAACCACCCTGGTTTGCCCTGG - Intergenic
1186634242 X:11384911-11384933 CCAATCATCCTTGTTTTTCCAGG - Intronic
1186717045 X:12263281-12263303 CCAACCATCCTGGTTTACCAGGG - Intronic
1186772068 X:12828013-12828035 CCAAACGTCCTGGTTTGCCCAGG - Intergenic
1186835271 X:13431229-13431251 CCAACCATTCTTATTTGCCCAGG - Intergenic
1187035844 X:15538364-15538386 CCAACTGTCCTGGTTTGCCTGGG - Intronic
1187153252 X:16700938-16700960 CCAACCTGCTTGGTTTGCCCAGG + Intronic
1187245933 X:17552994-17553016 CAACTCATCCTGGTTTGCCCAGG + Intronic
1187277861 X:17832211-17832233 CCAATTGTCCTGGTTTGCCCAGG + Intronic
1187931984 X:24302066-24302088 CCAACAATCCTGGTTTTCCCGGG - Intergenic
1188152902 X:26701026-26701048 TCAAACATCTTGGTTTTCCCAGG - Intergenic
1189128094 X:38469201-38469223 CCAACCATTCTGGTTTATCTGGG - Intronic
1189420778 X:40855829-40855851 CCAACCATCCTGGTTTGCCCAGG - Intergenic
1190436639 X:50432082-50432104 CCAACTGTCCTGGTTTTCCCAGG + Intronic
1191783706 X:64895044-64895066 CCAAGCATCCCAGTTTGCCCAGG + Intergenic
1192449546 X:71235321-71235343 CCAACCATCTCAGTTTGCCCAGG - Intergenic
1193458593 X:81761645-81761667 CCAACCATCCTTGCTTGCCTGGG - Intergenic
1194273887 X:91856313-91856335 TGAACCATCCTTGTTTACCAGGG + Intronic
1195039956 X:101004902-101004924 CAAAACATCCTGGTTTACCCAGG + Intergenic
1195400645 X:104457900-104457922 CCAACCATGCTAGCTTGCCCAGG + Intergenic
1195400659 X:104457973-104457995 CCAACCATTCTGGTTTGCCCAGG - Intergenic
1195458030 X:105091452-105091474 TCAACCATCCTGGTTTTCCCAGG + Intronic
1195458042 X:105091526-105091548 CTAACCATCCTGGTTTGCTTTGG - Intronic
1195710634 X:107770968-107770990 CCAACCATCCCAGTTTCCCTAGG + Intronic
1195913215 X:109910321-109910343 CCAACCATCCTGGTTTGCTTGGG - Intergenic
1198431748 X:136574388-136574410 CCATCCATCCTGGTTTGCATGGG + Intergenic
1199597083 X:149514588-149514610 CCAGCCATCCAGGTTGACCCGGG + Intronic
1199890729 X:152077066-152077088 CCAACCATTCAGGTTTTCCTGGG + Intergenic
1200207749 X:154329494-154329516 CCTAACATCCTTGTTTCCCCAGG + Exonic
1200591124 Y:5077730-5077752 TGAACCATCCTTGTTTACCAGGG + Intronic