ID: 944657594

View in Genome Browser
Species Human (GRCh38)
Location 2:201891527-201891549
Sequence ACAAAGGTGACCAACCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 2, 2: 8, 3: 40, 4: 200}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944657594_944657606 29 Left 944657594 2:201891527-201891549 CCAGGATGGTTGGTCACCTTTGT 0: 1
1: 2
2: 8
3: 40
4: 200
Right 944657606 2:201891579-201891601 AGGAGGAAGGGGTGCTGTGAAGG 0: 1
1: 0
2: 10
3: 89
4: 764
944657594_944657598 -2 Left 944657594 2:201891527-201891549 CCAGGATGGTTGGTCACCTTTGT 0: 1
1: 2
2: 8
3: 40
4: 200
Right 944657598 2:201891548-201891570 GTGGCACAAATTACCTTCCAGGG 0: 1
1: 0
2: 2
3: 9
4: 101
944657594_944657597 -3 Left 944657594 2:201891527-201891549 CCAGGATGGTTGGTCACCTTTGT 0: 1
1: 2
2: 8
3: 40
4: 200
Right 944657597 2:201891547-201891569 TGTGGCACAAATTACCTTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 114
944657594_944657601 12 Left 944657594 2:201891527-201891549 CCAGGATGGTTGGTCACCTTTGT 0: 1
1: 2
2: 8
3: 40
4: 200
Right 944657601 2:201891562-201891584 CTTCCAGGGTAATCTTGAGGAGG 0: 2
1: 0
2: 0
3: 7
4: 130
944657594_944657599 9 Left 944657594 2:201891527-201891549 CCAGGATGGTTGGTCACCTTTGT 0: 1
1: 2
2: 8
3: 40
4: 200
Right 944657599 2:201891559-201891581 TACCTTCCAGGGTAATCTTGAGG 0: 1
1: 1
2: 1
3: 12
4: 146
944657594_944657604 17 Left 944657594 2:201891527-201891549 CCAGGATGGTTGGTCACCTTTGT 0: 1
1: 2
2: 8
3: 40
4: 200
Right 944657604 2:201891567-201891589 AGGGTAATCTTGAGGAGGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 232
944657594_944657605 18 Left 944657594 2:201891527-201891549 CCAGGATGGTTGGTCACCTTTGT 0: 1
1: 2
2: 8
3: 40
4: 200
Right 944657605 2:201891568-201891590 GGGTAATCTTGAGGAGGAAGGGG 0: 1
1: 1
2: 1
3: 21
4: 269
944657594_944657603 16 Left 944657594 2:201891527-201891549 CCAGGATGGTTGGTCACCTTTGT 0: 1
1: 2
2: 8
3: 40
4: 200
Right 944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944657594 Original CRISPR ACAAAGGTGACCAACCATCC TGG (reversed) Intronic
901379637 1:8864278-8864300 ACAAAAGTCACCCACAATCCTGG + Intronic
901942183 1:12671217-12671239 ACAAATCTGATCAACCATCTGGG - Intergenic
902737715 1:18412325-18412347 ACTGGGGTGACCAACTATCCTGG + Intergenic
903793826 1:25913402-25913424 ATGAAGGTGACCAACTCTCCTGG + Intergenic
904273130 1:29363368-29363390 ACTATGATGACCAACCCTCCTGG + Intergenic
904996681 1:34636696-34636718 ACAAAGGTGTCAGACCATGCAGG - Intergenic
905806602 1:40881735-40881757 GCTAGGGAGACCAACCATCCAGG - Intergenic
908226290 1:62059343-62059365 ACAGGGGTGAGCAACCATGCTGG - Intronic
911771005 1:101742250-101742272 ACGAAGGTGACAAGCCATCCTGG - Intergenic
912489070 1:110051472-110051494 GTTAGGGTGACCAACCATCCTGG + Intronic
915239338 1:154508724-154508746 AGAAGGCTGACCAACCATCCAGG - Intronic
918518320 1:185386888-185386910 AAATAGGTGACCAACCATTCAGG + Intergenic
920013045 1:202884090-202884112 ACAAAGGTAACCAACCCATCTGG - Intronic
920079101 1:203359345-203359367 ACAAAGCTTACCAAACAGCCTGG - Intergenic
920125933 1:203693789-203693811 AGTAGGGTGGCCAACCATCCCGG + Intronic
920452405 1:206069518-206069540 AGAAGAATGACCAACCATCCTGG + Intronic
921078548 1:211720315-211720337 AGTAGGGTGACCAAACATCCTGG - Intergenic
921980723 1:221255611-221255633 ACAAAGAAGACCTGCCATCCTGG + Intergenic
923005871 1:230049230-230049252 AGTAGGGTGACCAACCATTCTGG - Intergenic
924574643 1:245268807-245268829 ATTAAGGTGACCAAACATCCTGG + Intronic
1063493444 10:6486090-6486112 ACAAAGGTGGCCAACCTTTGTGG - Exonic
1063962907 10:11321906-11321928 AGAAAGGTGATCAACTTTCCTGG - Intronic
1064536849 10:16366165-16366187 CATAGGGTGACCAACCATCCAGG - Intergenic
1065861011 10:29872410-29872432 ATTAGGGTGAACAACCATCCTGG + Intergenic
1067232042 10:44418751-44418773 ACAGAGGTGAAGAACCAGCCTGG + Intergenic
1067535366 10:47105522-47105544 GCAAGGGTGTCCCACCATCCTGG + Intergenic
1068771427 10:60825911-60825933 ACAAAGGTGATCTTTCATCCTGG - Intergenic
1068793464 10:61052417-61052439 TTTACGGTGACCAACCATCCCGG + Intergenic
1069020946 10:63487881-63487903 ACAAATGTGAACTAGCATCCTGG - Intergenic
1069709546 10:70479659-70479681 AGAAAGGGCTCCAACCATCCCGG - Intronic
1069844113 10:71358791-71358813 GCTAGGCTGACCAACCATCCTGG - Intronic
1070263372 10:74879326-74879348 ACTAGGATGGCCAACCATCCTGG - Intronic
1070848802 10:79546011-79546033 GCAAGGGTGACCAACCTTCCTGG - Intergenic
1070924988 10:80214180-80214202 GCAAGGGTGACCAACCTTCCTGG + Intergenic
1071264834 10:83955895-83955917 ACAGAGGTGTCCAGGCATCCTGG - Intergenic
1075256701 10:120931014-120931036 ACCAGGATGACCAACCATTCTGG + Intergenic
1075982178 10:126749493-126749515 AAAATGGCAACCAACCATCCAGG + Intergenic
1077880390 11:6344648-6344670 AATAGGGTGACCAACTATCCTGG + Intergenic
1077880399 11:6344713-6344735 AGGCAGATGACCAACCATCCTGG - Intergenic
1078473589 11:11611554-11611576 CCTCAGATGACCAACCATCCAGG + Intronic
1079194242 11:18311300-18311322 GTTAGGGTGACCAACCATCCTGG - Intronic
1080329861 11:31123795-31123817 ACCAGGGTGACCAACCATCTTGG + Intronic
1081591283 11:44424988-44425010 AGAGAGGTGACTAAACATCCTGG + Intergenic
1083643883 11:64160893-64160915 ACAAGTGTGAGCCACCATCCCGG - Intronic
1085115989 11:73932312-73932334 AGAAAATTGACCAACCATCTGGG - Intergenic
1085869822 11:80336010-80336032 ACTAGGGTGACCAAAAATCCTGG - Intergenic
1086606913 11:88706608-88706630 AATAAGGTGACCATCCATCCAGG - Intronic
1087622475 11:100558158-100558180 CCTAAGGTGACCAGGCATCCTGG + Intergenic
1088594981 11:111434792-111434814 AGAAAGAGGACCACCCATCCAGG + Intronic
1089733610 11:120534880-120534902 GTTAGGGTGACCAACCATCCTGG + Intronic
1090677095 11:129008521-129008543 CACAAGGTGACCAACCATCCTGG + Intronic
1091232925 11:134000071-134000093 CCTAAGGTAACCATCCATCCTGG + Intergenic
1091691633 12:2601354-2601376 AGCAGGGTGACCAGCCATCCTGG - Intronic
1092283177 12:7112905-7112927 AATAAGGTGACCAACTGTCCTGG - Intergenic
1094488358 12:30942588-30942610 ACACAGGTAGCAAACCATCCAGG + Intronic
1095801309 12:46271924-46271946 ACAAAGCTGCCCCACCTTCCTGG - Intergenic
1096919762 12:55071625-55071647 GCTAGGGTGACCAACCATCCTGG + Intergenic
1098728275 12:73997812-73997834 AGCAGGGTGACCAACCATCCTGG + Intergenic
1100568182 12:95818879-95818901 TCTAAAGTGACCAACCATCCAGG - Intronic
1101413460 12:104488789-104488811 ACAACGGTGAACAACCAAACAGG - Intronic
1101816067 12:108147122-108147144 TCCAGGGTGACCCACCATCCAGG - Intronic
1103054093 12:117805008-117805030 AGTAGGGTGACCAACCATCGCGG + Intronic
1103098652 12:118153128-118153150 ACAGAGGTGAGCCACCAGCCAGG - Intronic
1103139415 12:118535632-118535654 AGTAGGGTGACCAACCATCCAGG - Intergenic
1106514353 13:30440201-30440223 CTCAGGGTGACCAACCATCCTGG - Intergenic
1107402784 13:40085743-40085765 CCCAGGGTGATCAACCATCCTGG - Intergenic
1110617259 13:77554871-77554893 CCTAGGGTGACCAGCCATCCAGG + Intronic
1113345019 13:109468526-109468548 ACAAAGGTGACCATGTGTCCTGG + Intergenic
1114418343 14:22558852-22558874 TCAAAGGTGGCGAACCGTCCTGG - Exonic
1115328486 14:32168241-32168263 ACTAGGGTGACCAACAGTCCCGG - Intergenic
1115694446 14:35881456-35881478 ACAGGGGTTACCAACCAGCCTGG + Intronic
1118325248 14:64776032-64776054 AAAAAGGTGACCAGCCACCAGGG - Intronic
1119762085 14:77158818-77158840 GCCAGGGTGACCAACCCTCCTGG + Intronic
1121375443 14:93405921-93405943 ACTAAGGTGACCAACTATCCTGG + Intronic
1121712979 14:96052989-96053011 GGTAAGGTGACCAACCACCCCGG + Intronic
1121820545 14:96962321-96962343 AGAAGGGTGACCAACCATTCTGG + Intergenic
1122364727 14:101187844-101187866 AGTAGGGTCACCAACCATCCTGG - Intergenic
1125454651 15:39844849-39844871 CCTAGGGTGACCAACCATCCTGG + Intronic
1125736034 15:41926482-41926504 ACAAAGGTGAACATGCAGCCAGG - Intronic
1126684215 15:51233233-51233255 ATAAGTGTGACCAACTATCCTGG + Intronic
1127388476 15:58486369-58486391 ACTAGGGTGACCAACCATCCTGG - Intronic
1130047317 15:80455586-80455608 ACAAAAGTGACCAACCATCCTGG + Intronic
1130122616 15:81064405-81064427 TCCAGGGTGACCAAACATCCTGG + Intronic
1133180022 16:4047241-4047263 AGAAGGGTGTCCAAACATCCTGG - Intronic
1134273725 16:12757275-12757297 ATTAGGGTGACCAACCAGCCTGG - Intronic
1134735166 16:16493858-16493880 ACTAGGGTGACTATCCATCCTGG - Intergenic
1134932354 16:18218359-18218381 ACTAGGGTGACTATCCATCCTGG + Intergenic
1137810171 16:51345063-51345085 ATTAAGGTGACCAACCATCCTGG + Intergenic
1138155004 16:54694945-54694967 AACACGGTGACCAACCCTCCAGG + Intergenic
1138161327 16:54757572-54757594 GTAAAAGTGACCAACCATCCTGG - Intergenic
1139435558 16:66934729-66934751 CCAGAGGCGACCAACCGTCCTGG - Exonic
1139737082 16:69000057-69000079 ACAAAGGTAACCAAATTTCCTGG - Intronic
1139801379 16:69525813-69525835 AGAAGGGTGACCAACCATCCCGG + Intergenic
1140074843 16:71689005-71689027 ACAAAAGATACCAACCAGCCTGG + Intronic
1141469045 16:84226092-84226114 AATAGGGTGACCAACCATCCCGG - Intronic
1141834650 16:86530761-86530783 ACAAACGTGACCAGCCGTGCGGG + Exonic
1142629699 17:1216851-1216873 ACAAAGGTTACCAACAAGCTCGG + Intronic
1142776550 17:2144492-2144514 ACAAAGGTGACCAGGCATGGTGG - Intronic
1143790294 17:9289563-9289585 ACAAAGGGGAAAATCCATCCTGG + Intronic
1146463734 17:33068255-33068277 TCTACAGTGACCAACCATCCTGG - Intronic
1147854011 17:43464748-43464770 ACCAAAGTAACCAACCATCTTGG - Intergenic
1148870192 17:50654460-50654482 AGTAAAGTAACCAACCATCCTGG + Intronic
1149879427 17:60273467-60273489 ACAAAGCTTACAAACAATCCTGG + Intronic
1150449691 17:65256552-65256574 AGAATGGTGACCAAACTTCCTGG + Intergenic
1151227439 17:72657586-72657608 ACTAGGGTGCCCAACCATTCCGG + Intronic
1155077185 18:22369277-22369299 ACTAGGGTGAACAACCATCCTGG - Intergenic
1155651651 18:28150618-28150640 AAAAAGGGTACCAACCAGCCAGG + Intronic
1156602409 18:38624907-38624929 ACAGAGGTGAAAAACCATCTAGG - Intergenic
1158428204 18:57358663-57358685 AAAAAGGTGACCATATATCCTGG - Intronic
1158672689 18:59491219-59491241 ACCATGGTTACCAAGCATCCTGG + Intronic
1160076208 18:75680066-75680088 TCAAAAGTGACTAACCAGCCAGG - Intergenic
1161959373 19:7515385-7515407 ACAGCGGTGACCCACCATCTGGG + Intronic
1162531740 19:11239992-11240014 TCTAGGGTAACCAACCATCCTGG + Intronic
1165941301 19:39415957-39415979 ACCACAGTGACCAACCATCCTGG - Intronic
1167695080 19:51010373-51010395 ACCCAGGTGCCCAACCTTCCAGG + Intergenic
1167816951 19:51891347-51891369 ACAAAGGAGAGAAACCATACGGG - Exonic
926584994 2:14675870-14675892 CCTGGGGTGACCAACCATCCTGG - Intergenic
927022812 2:19035169-19035191 ACAAAATTGACCTACCATTCTGG + Intergenic
927193883 2:20534696-20534718 AATAGGGTGAGCAACCATCCTGG + Intergenic
927813838 2:26196613-26196635 AATAGGGTGACCAACCATCTTGG - Intronic
928299926 2:30116089-30116111 AGAGCGGTGACCAACCATTCTGG + Intergenic
928436700 2:31259135-31259157 ACTAAAGTGACCAACCATCCTGG - Intronic
929379389 2:41332658-41332680 TCTAGGGTGACCAACCATTCTGG + Intergenic
929379406 2:41332755-41332777 GGAAGGGTGACCAGCCATCCAGG - Intergenic
929746565 2:44665569-44665591 AAAAATCTGATCAACCATCCAGG - Intronic
931798946 2:65740159-65740181 GCTAGGGTGATCAACCATCCAGG + Intergenic
932055471 2:68438823-68438845 AGTAGGGTGACCAACCATCCTGG - Intergenic
932770023 2:74495724-74495746 AGTAGAGTGACCAACCATCCTGG + Intergenic
932840235 2:75074953-75074975 TCTAAAGTGACCAACCATCCTGG - Intronic
933777789 2:85781597-85781619 ACAGATGTGAGCCACCATCCTGG - Intronic
935827408 2:106965210-106965232 GCAAGGGTGACCAACCACCCTGG - Intergenic
937198890 2:120184144-120184166 ACATAAGTGACCAATCATCCTGG + Intergenic
938991419 2:136633743-136633765 ACAAAAATGAGCAAACATCCAGG - Intergenic
939049719 2:137293413-137293435 ACATGGGTGACCCACCATGCTGG + Intronic
940653269 2:156458332-156458354 GCAAAGCTGATCAACCTTCCTGG - Intronic
941466020 2:165828292-165828314 CATAAGGTGACCAACCATTCTGG - Intergenic
941494937 2:166188174-166188196 ACAAAGCTGAGGAACCATTCTGG - Intergenic
943132640 2:183873654-183873676 ACAAAGGAGAATATCCATCCAGG - Intergenic
944657594 2:201891527-201891549 ACAAAGGTGACCAACCATCCTGG - Intronic
948692976 2:239718640-239718662 ATCCAGGTGACCATCCATCCAGG + Intergenic
948692990 2:239718720-239718742 ATCCAGGTGACCATCCATCCAGG + Intergenic
948693002 2:239718784-239718806 ATCCAGGTGACCATCCATCCAGG + Intergenic
948693016 2:239718864-239718886 ATCCAGGTGACCATCCATCCAGG + Intergenic
948693034 2:239718960-239718982 ATCCAGGTGACCATCCATCCAGG + Intergenic
948693048 2:239719040-239719062 ATCCAGGTGACCATCCATCCAGG + Intergenic
948693052 2:239719056-239719078 ATCCAGGTGACCATCCATCCAGG + Intergenic
948693085 2:239719248-239719270 ATCCAGGTGACCATCCATCCAGG + Intergenic
948693132 2:239719488-239719510 ATCCAGGTGACCATCCATCCAGG + Intergenic
948693188 2:239719775-239719797 ATCCAGGTGACCATCCATCCAGG + Intergenic
948693197 2:239719823-239719845 ATCCAGGTGACCATCCATCCAGG + Intergenic
948693201 2:239719839-239719861 ATCCAGGTGACCATCCATCCAGG + Intergenic
948693211 2:239719887-239719909 ATCCAGGTGACCATCCATCCAGG + Intergenic
948693247 2:239720047-239720069 ATCTAGGTGACCATCCATCCAGG + Intergenic
1169892993 20:10473813-10473835 AAAAAGAAGACCAACCAGCCGGG - Intronic
1170438703 20:16356064-16356086 GGTAGGGTGACCAACCATCCAGG - Intronic
1170606221 20:17876756-17876778 ACAGGTGTGACCAACCACCCTGG - Intergenic
1172127430 20:32633226-32633248 TTTAGGGTGACCAACCATCCTGG - Intergenic
1172313968 20:33939239-33939261 ACAAGGGTGCACAACCAACCAGG + Intergenic
1173650454 20:44660570-44660592 ACTAGGGTGACCAACCATCCTGG + Intergenic
1174501901 20:50991293-50991315 ACTAGGATGACCAACCATTCTGG - Intergenic
1174579997 20:51564539-51564561 AACAGGGTGACCAACCTTCCTGG + Intergenic
1178242533 21:30919168-30919190 AGGAAAGTGACCAACCATCCTGG - Intergenic
1178742485 21:35215138-35215160 ACAAAGGTGACCCTCCTTACTGG - Intronic
1183212016 22:36457064-36457086 TCTTGGGTGACCAACCATCCTGG - Intergenic
950148982 3:10671515-10671537 CCTAGGGTGACCAACCATCCTGG - Intronic
950708445 3:14798256-14798278 CCAAAGCTGACCAATCATTCCGG - Intergenic
950770289 3:15305763-15305785 ATAAGGGTGGCCATCCATCCTGG + Intronic
950779541 3:15379503-15379525 AGTAAGATGACCAACCATCTGGG - Intergenic
951196332 3:19827709-19827731 ACAGGGGTGAGCAACCAGCCTGG - Intergenic
953405535 3:42657937-42657959 ACCACAGTGACCAACCATCCAGG - Intronic
954267775 3:49483497-49483519 ACAGAGGTGACCTACAGTCCAGG - Intronic
954448128 3:50557528-50557550 ACTAGGGTGACCAGCCATCCTGG - Intergenic
957345700 3:78958791-78958813 GAAAGGGTGACCAAGCATCCTGG - Intronic
960810705 3:121624649-121624671 ACAAAGGGGAGGAACCATGCAGG - Intronic
962218266 3:133541468-133541490 CATATGGTGACCAACCATCCTGG - Intergenic
962427892 3:135289202-135289224 ACAAGTGTGAGCCACCATCCTGG + Intergenic
962704604 3:138030815-138030837 ACTAAGGTTACTAACTATCCTGG + Intronic
962792689 3:138825763-138825785 GCAAAGGTGACCACCATTCCGGG - Intronic
964093020 3:152898205-152898227 CCTAAGATGTCCAACCATCCTGG - Intergenic
964574690 3:158152284-158152306 GCTAGGGTGACCAACCATCTTGG + Intronic
966297910 3:178445186-178445208 TTTAGGGTGACCAACCATCCTGG + Intronic
967539124 3:190644182-190644204 ACCACAGTGACCCACCATCCCGG - Intronic
968268426 3:197380629-197380651 ACTAGAGTGACCAACCATCGTGG + Intergenic
968540094 4:1163728-1163750 ACAAAAATGACCAACCAACAAGG - Intergenic
971069790 4:23078861-23078883 ACAAAGGTGAATAATCATTCTGG + Intergenic
979783140 4:124681402-124681424 ACAAGGGGGACAATCCATCCTGG + Intronic
982916762 4:161220759-161220781 ACAAAGGTGAAAAAACTTCCAGG + Intergenic
992068927 5:73131844-73131866 ACAAGGGTAACCAACCTTCCAGG + Intergenic
994950239 5:106452515-106452537 AGAAAGGTGAACAACAATCAAGG - Intergenic
995106881 5:108385109-108385131 ACAAAAATGACCAAACATTCTGG + Intergenic
995956345 5:117781250-117781272 AAAAAGGTGATCAACAGTCCAGG + Intergenic
997558543 5:134822851-134822873 ACAAACGTGAGCCACCATGCTGG + Intronic
997587355 5:135051360-135051382 ACATATGTGACAAACCATACTGG - Intronic
999440209 5:151595050-151595072 ACTAGGGTGACCAGCCATTCTGG - Intergenic
999800370 5:155027864-155027886 ACTAAGGTGGACAACCATCTTGG + Intergenic
1000882884 5:166717520-166717542 ACAAAGGTGAATAACCAAACTGG + Intergenic
1001862476 5:175069647-175069669 AGTAGAGTGACCAACCATCCTGG + Intergenic
1003320574 6:5047351-5047373 AGTAGGGTGACCAACCATCCTGG - Intergenic
1003534265 6:6962563-6962585 AACAAGATGACCAACCATCCTGG + Intergenic
1004172527 6:13307917-13307939 ACTAAAGTAACAAACCATCCAGG + Intronic
1005122460 6:22404680-22404702 GCAAAGGTGACCAATCGTCCTGG + Intergenic
1008295904 6:49776548-49776570 CCTAGGGTGACCAACCATTCTGG + Intergenic
1008961185 6:57267846-57267868 ACAAGGGTGAGCCACCGTCCTGG + Intergenic
1011080425 6:83484724-83484746 ACCAGAGTGACCAACCATCATGG + Intergenic
1013630694 6:111983337-111983359 ACAAAAGTGAGCAACCAACTGGG - Intergenic
1013975558 6:116074375-116074397 AGAAGGGTGACCAACCATTTGGG - Intergenic
1015408802 6:132868501-132868523 TCAAAGGAGAACATCCATCCTGG - Intergenic
1016694839 6:146980951-146980973 ACACAGGTGACCTAACAGCCTGG - Intergenic
1017650363 6:156576003-156576025 ACAAAATTGAACAACCATCAGGG + Intergenic
1018513666 6:164554785-164554807 ACAAGGGTGACAGACCATGCAGG + Intergenic
1020258651 7:6517616-6517638 ACAAAGGTGTCCAGCCGTCGTGG + Intronic
1020721930 7:11756275-11756297 ACAAAGATGACCAAACATTTTGG + Intronic
1021800386 7:24299516-24299538 GGCAAGGTGACCAACCATTCTGG + Intergenic
1022692689 7:32672530-32672552 ACAAGGGTGACTAACCATCAAGG + Intergenic
1022920365 7:35007055-35007077 ACAAGGGTGACTAACCATCAAGG + Intronic
1023330933 7:39116106-39116128 ACAGATGTGAGCCACCATCCCGG - Intronic
1023579905 7:41670704-41670726 GCAAAGGTGAGTAACCATACAGG + Intergenic
1023599821 7:41870726-41870748 ACTAGGGTGACCAACTATCCTGG - Intergenic
1028224488 7:88233955-88233977 GCTAGGGTGACCAACCATCCTGG - Intergenic
1028739093 7:94251335-94251357 AGACAGGTGACAAACCTTCCAGG - Intergenic
1032582704 7:133117962-133117984 CCTAGGGTGACCAACCATCTTGG + Intergenic
1034387091 7:150749008-150749030 CAAAGGGTGACCAACCATCCTGG + Intronic
1035398992 7:158552384-158552406 AGAAAGGTGACCATACATTCTGG + Intronic
1037880902 8:22572942-22572964 ATCAAGGTGACCAACCCACCAGG + Intronic
1038545491 8:28423008-28423030 ACCTGGGTGACCAAGCATCCTGG - Intronic
1039023359 8:33231329-33231351 ACAAAGGAGAGAAACCACCCTGG + Intergenic
1041248257 8:55909334-55909356 ACAGTGGGGACCAGCCATCCAGG + Intronic
1042341803 8:67687271-67687293 TCAAGGGAGACCAACCATCCTGG - Intronic
1045681488 8:104665570-104665592 TCTAGGGTTACCAACCATCCTGG - Intronic
1045762863 8:105630961-105630983 CCTAGGGTGAACAACCATCCTGG - Intronic
1047442131 8:124887647-124887669 CCCACGGTGACCAACCATTCTGG - Intergenic
1047678652 8:127230825-127230847 GCTTAGGTGACCAACCAACCTGG - Intergenic
1049776453 8:144408066-144408088 CCAAAGGAGGCCAACCCTCCTGG - Intronic
1050008571 9:1160987-1161009 ACTAAGGTGACCAACCATCCTGG + Intergenic
1053267397 9:36725115-36725137 AGTATGGTGACCAACCATCTCGG - Intergenic
1054931875 9:70643577-70643599 GCTAAGGTGACCAGCCATCCAGG + Intronic
1057750679 9:97790321-97790343 GGTAGGGTGACCAACCATCCTGG + Intergenic
1058777059 9:108294457-108294479 GGAAAGGTGACCAACTGTCCTGG + Intergenic
1059531151 9:115036816-115036838 TCACAGGTGACCAACCATCCTGG + Intronic
1060289184 9:122284632-122284654 ACTAGGGTGGCCAACCATCCTGG - Intronic
1061219966 9:129244706-129244728 ACAAACGTGAGCCACCATGCTGG - Intergenic
1061905013 9:133692259-133692281 ACACAGGTCACCAAAAATCCTGG - Intronic
1186717048 X:12263291-12263313 CCTAAGGTGACCAACCATCCTGG - Intronic
1187931987 X:24302076-24302098 ATTAGGGTGACCAACAATCCTGG - Intergenic
1188617173 X:32172188-32172210 ACAAAGCTGACCAATCATTCAGG - Intronic
1189128097 X:38469211-38469233 GCTAGGGTGACCAACCATTCTGG - Intronic
1189610350 X:42726743-42726765 ATAAAGGTGAACAACCATTTGGG - Intergenic
1192315706 X:70049808-70049830 GGTAGGGTGACCAACCATCCTGG - Intronic
1195400661 X:104457983-104458005 AGCAGGGTGACCAACCATTCTGG - Intergenic
1195973632 X:110501101-110501123 ACAAAAGTGACTAATTATCCAGG + Intergenic
1200294811 X:154909193-154909215 GCAAAGCTGACCAATCATGCTGG + Intronic