ID: 944657596

View in Genome Browser
Species Human (GRCh38)
Location 2:201891543-201891565
Sequence GAAGGTAATTTGTGCCACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944657596_944657603 0 Left 944657596 2:201891543-201891565 CCTTTGTGGCACAAATTACCTTC 0: 1
1: 0
2: 1
3: 15
4: 96
Right 944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 171
944657596_944657604 1 Left 944657596 2:201891543-201891565 CCTTTGTGGCACAAATTACCTTC 0: 1
1: 0
2: 1
3: 15
4: 96
Right 944657604 2:201891567-201891589 AGGGTAATCTTGAGGAGGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 232
944657596_944657606 13 Left 944657596 2:201891543-201891565 CCTTTGTGGCACAAATTACCTTC 0: 1
1: 0
2: 1
3: 15
4: 96
Right 944657606 2:201891579-201891601 AGGAGGAAGGGGTGCTGTGAAGG 0: 1
1: 0
2: 10
3: 89
4: 764
944657596_944657601 -4 Left 944657596 2:201891543-201891565 CCTTTGTGGCACAAATTACCTTC 0: 1
1: 0
2: 1
3: 15
4: 96
Right 944657601 2:201891562-201891584 CTTCCAGGGTAATCTTGAGGAGG 0: 2
1: 0
2: 0
3: 7
4: 130
944657596_944657599 -7 Left 944657596 2:201891543-201891565 CCTTTGTGGCACAAATTACCTTC 0: 1
1: 0
2: 1
3: 15
4: 96
Right 944657599 2:201891559-201891581 TACCTTCCAGGGTAATCTTGAGG 0: 1
1: 1
2: 1
3: 12
4: 146
944657596_944657605 2 Left 944657596 2:201891543-201891565 CCTTTGTGGCACAAATTACCTTC 0: 1
1: 0
2: 1
3: 15
4: 96
Right 944657605 2:201891568-201891590 GGGTAATCTTGAGGAGGAAGGGG 0: 1
1: 1
2: 1
3: 21
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944657596 Original CRISPR GAAGGTAATTTGTGCCACAA AGG (reversed) Intronic
902536280 1:17120722-17120744 GGAGGTCATTTGTCCCCCAAAGG + Intergenic
911745398 1:101436503-101436525 GAAGGTCATTTGTTCCATAAAGG + Intergenic
912389239 1:109290497-109290519 TAAGTTAATTTATGACACAAAGG + Intergenic
918112325 1:181467825-181467847 GGAGGTGATTTGGGCCCCAAGGG + Intronic
920288066 1:204895965-204895987 GAAGGGAATTTGTTCTGCAAAGG + Intronic
1068288333 10:54968700-54968722 GAAAGTATTTTATGACACAATGG - Intronic
1071075981 10:81753479-81753501 GAAAGTGATTTATGCCACAGGGG + Intergenic
1074204582 10:111271814-111271836 GAAGTTCCTTTGAGCCACAAAGG - Intergenic
1077724560 11:4661311-4661333 CAAGGTAACTTGAGCCACAATGG + Intergenic
1089030578 11:115323910-115323932 CAATCTAATTTGGGCCACAATGG + Intronic
1090625695 11:128606602-128606624 GAATGACATCTGTGCCACAAGGG - Intergenic
1095194430 12:39296501-39296523 GAAGGTGACTAGTGCCACAGGGG + Intronic
1095233945 12:39775240-39775262 TAAAGTAAATTGGGCCACAAAGG + Intronic
1095318456 12:40795682-40795704 GAATCTAATTTCTGCCAGAAAGG - Intronic
1095669208 12:44838365-44838387 GTAGGTAATTTGTGTGGCAAGGG - Intronic
1098415269 12:70227455-70227477 GAAGGTGATTTGTGCTGTAATGG - Intergenic
1099784985 12:87250736-87250758 GAAAATATTTTGTGCAACAAGGG + Intergenic
1103850013 12:123926817-123926839 AAAGGTAATTTGTGGCTGAAAGG + Exonic
1107162044 13:37241586-37241608 GAAGGTAAATTGTGCCACAGGGG - Intergenic
1109776509 13:67048145-67048167 GAAGGTAATTTATTTCAAAAAGG + Intronic
1111394481 13:87647280-87647302 TAAGATAATTTTTGCCAAAAAGG + Intergenic
1112974286 13:105298009-105298031 GAACTTCATTTGTGCCAGAACGG - Intergenic
1115154274 14:30320506-30320528 GAAGGAAAATTGTGCCACCAGGG + Intergenic
1116475485 14:45334183-45334205 AAAGGAAATTTGGTCCACAATGG - Intergenic
1123202815 14:106682588-106682610 GAAGGTAATGTGTGGGACAGGGG + Intergenic
1126908480 15:53393084-53393106 TAAGATAATTTGTGCAACAAGGG + Intergenic
1127479538 15:59365841-59365863 GAAGTTACATTGTGCCTCAAAGG - Intronic
1127660472 15:61095838-61095860 GAAAGTAGTTTGTGTCCCAAGGG - Intronic
1129930991 15:79411268-79411290 AAAGGTAAATTCTTCCACAAAGG + Intronic
1131575742 15:93589016-93589038 GAAGAGAAATTATGCCACAATGG - Intergenic
1133184128 16:4082995-4083017 GCAGCCACTTTGTGCCACAAGGG + Intronic
1134891702 16:17846845-17846867 GAAGCTATTTTGTGCTACAGTGG - Intergenic
1138026485 16:53526168-53526190 AAAACTAATTTTTGCCACAATGG - Intergenic
1138211120 16:55164175-55164197 GAAGGAAATTTTGGCCACAATGG + Intergenic
1139769994 16:69266594-69266616 GAAGGTATTTTGAGCCCTAAAGG - Intronic
1140973667 16:80038575-80038597 GAAGGTACTATCTTCCACAAAGG + Intergenic
1145415840 17:22713164-22713186 GATGGTAATTTGTGCTGAAAAGG - Intergenic
1145715685 17:27018165-27018187 GAGGGTAATTTTTGTAACAAAGG + Intergenic
1150826931 17:68484942-68484964 GAATGTGTTTTCTGCCACAATGG + Intergenic
1152665911 17:81569390-81569412 GAAGGGAAGCTGTGCCACGAGGG - Intronic
1153344035 18:4007113-4007135 GAAGATAATATGTGTCACCAGGG - Intronic
1154472267 18:14715902-14715924 GAGGGTAATTTTTGTAACAAAGG - Intergenic
1157042183 18:44053099-44053121 ATAGGTACTTTATGCCACAAGGG - Intergenic
1157813386 18:50713915-50713937 GGAGGAAATATGTGCCACAGAGG + Intronic
1158248645 18:55461472-55461494 AAAGCAAAATTGTGCCACAAGGG + Intronic
1165053110 19:33155757-33155779 GAGGGCAATTTGTGCCCCAGTGG + Intronic
1168697509 19:58412643-58412665 GAGGGTAATTTTGGCCTCAATGG + Intronic
928069224 2:28198052-28198074 GAAGGTAATCTGTGCTACAGAGG + Intronic
930578128 2:53177284-53177306 GGAGGAAATTTGTGTCACTAAGG - Intergenic
930886675 2:56334148-56334170 GAAGGTGATTTGTACAACAAAGG - Intronic
931407054 2:61989230-61989252 GATGGTAATTTGTTAAACAATGG + Intronic
939233789 2:139465484-139465506 GAGTATAAATTGTGCCACAAAGG - Intergenic
940896104 2:159082872-159082894 TAAGGGAATTTGAGTCACAAGGG - Intronic
943869082 2:192969616-192969638 TAAGGTAATTTGACCAACAATGG + Intergenic
944426979 2:199594160-199594182 GAAGTTCATTTATGCCAAAAGGG + Intergenic
944657596 2:201891543-201891565 GAAGGTAATTTGTGCCACAAAGG - Intronic
944908822 2:204289308-204289330 GAAGGTAATTTCTGGGACAGTGG - Intergenic
946697238 2:222372117-222372139 AAAGGTAATCTAGGCCACAAGGG + Intergenic
947946360 2:234106287-234106309 GAAGTTAATTTGGTCCACACTGG - Intergenic
1169628910 20:7603031-7603053 GAAAGTAAGTTATACCACAAGGG + Intergenic
1171373243 20:24675077-24675099 GAAGGTGATTGGTCCCAGAAAGG + Intergenic
1176802223 21:13442002-13442024 GAGGGTAATTTTTGTAACAAAGG + Intergenic
1178809687 21:35870097-35870119 CAAGGTGATTTTTGCCACAAGGG - Intronic
1184127156 22:42495671-42495693 GGAGGAAATTTATTCCACAACGG - Intergenic
1184134546 22:42539315-42539337 GGAGGAAATTTATTCCACAACGG - Intergenic
1184706461 22:46216989-46217011 GATGGTACATTGTGCCAGAAAGG - Intronic
949156632 3:834968-834990 AAAGGTAAATTTTTCCACAAAGG + Intergenic
949694648 3:6680699-6680721 AAAGTAAATTTTTGCCACAATGG + Intergenic
952459058 3:33505013-33505035 GAAGATAATTTGTGAAATAAGGG - Intronic
959342869 3:105153033-105153055 AAAAGAAATTTGTGCCATAAAGG + Intergenic
960079471 3:113525909-113525931 GGAGGTTAATTGTGCCTCAATGG + Intergenic
964788172 3:160422652-160422674 AAAGATAAATTGTGCCTCAAAGG - Intronic
964828612 3:160858195-160858217 GAAAGTTATTTGTGCTAAAATGG - Intronic
966859253 3:184219987-184220009 GAATGTACTTAGTGCCACAGAGG + Intronic
967900715 3:194448863-194448885 GAAAGTGATTTGTGGCTCAAAGG + Intronic
970944360 4:21672691-21672713 GAGGGTAATTTGTTACACAAAGG - Intronic
971913335 4:32825277-32825299 TAAGTTATTGTGTGCCACAAAGG - Intergenic
974139134 4:57861773-57861795 TAAGGCTCTTTGTGCCACAAAGG + Intergenic
980749808 4:137073852-137073874 GAGGGAAATTAGTGCTACAAAGG - Intergenic
981488082 4:145308832-145308854 GAAGCTAATATGTGCAAAAAGGG + Intergenic
982694315 4:158582259-158582281 AAAGGTAATTTCTGCTACAAGGG + Intronic
985315333 4:188653290-188653312 GAAGGTCCTTTGAGCCTCAATGG + Intergenic
987026601 5:13933102-13933124 GAAGTTATTTTGTCCCACAGGGG - Intronic
988287640 5:29240849-29240871 GCAAGTAATTTGTGCTACTAAGG - Intergenic
991130616 5:63118572-63118594 CAAGGTAATTTGTGTCATAATGG - Intergenic
993129307 5:83875405-83875427 GAAGCAGATTTGTGCCACAGTGG + Intergenic
994303416 5:98173947-98173969 GTAGGTGATATGTGCTACAAAGG - Intergenic
997483765 5:134210832-134210854 GAATGTAATTAGTACCACACTGG + Intronic
997659737 5:135579871-135579893 GGAGGGAATTTCTGCCACTATGG - Intergenic
1003740966 6:8939064-8939086 AAAGGTAATATATGCTACAATGG - Intergenic
1006878326 6:37317400-37317422 GAAGGGTGTTTGTGCCAGAATGG + Intronic
1010278095 6:73991860-73991882 AAAGGTAGTTTGTCCCACAGGGG + Intergenic
1013338467 6:109189773-109189795 GAAGATATTTTGTGCCCCAAGGG + Intergenic
1016173484 6:141049292-141049314 GAATATAATTTGTTGCACAAGGG - Intergenic
1016685840 6:146881276-146881298 GAAGGGAGTTGGTGCCACAGTGG - Intergenic
1019009241 6:168828188-168828210 GAAGGCACTATGTGCTACAATGG - Intergenic
1021530788 7:21642275-21642297 GATGGTTATTTGTACCACAAAGG - Intronic
1027897119 7:84059322-84059344 GGAGATAATTCATGCCACAATGG + Intronic
1031060569 7:117046684-117046706 AAAGGTGATTTGTGCAATAATGG + Intronic
1031543602 7:123026094-123026116 GAAGGTAATTGGTGATACACTGG - Intergenic
1032981178 7:137284991-137285013 GAAGGTAATTTGTTTCACATTGG + Intronic
1033030117 7:137818396-137818418 GATGGGAATATGTGCCAAAATGG - Intronic
1041640318 8:60192767-60192789 GAAGGAAATTGGTGACACATAGG - Intronic
1041887390 8:62826208-62826230 GAAGGCAATTTGAGCCATAAAGG + Intronic
1046426922 8:114065658-114065680 GAATGTAATATGCTCCACAAAGG - Intergenic
1046614246 8:116458644-116458666 AAATGTAAATTGTGCAACAAAGG + Intergenic
1049083886 8:140463019-140463041 GAAGGCAATTTGAGACAGAATGG + Intergenic
1050629734 9:7545800-7545822 CAAAGTAAATTCTGCCACAAAGG - Intergenic
1050726735 9:8658419-8658441 TAAGGCAATTTTTCCCACAAAGG + Intronic
1060344919 9:122807634-122807656 GACAATAATGTGTGCCACAATGG - Intronic
1186164524 X:6812409-6812431 GAAGGTAATTTGCATAACAATGG - Intergenic
1199583574 X:149386733-149386755 GAAGGCAATTTTGGCCCCAAGGG + Intergenic
1201630067 Y:16061625-16061647 AAAGTTATTGTGTGCCACAAAGG - Intergenic