ID: 944657603

View in Genome Browser
Species Human (GRCh38)
Location 2:201891566-201891588
Sequence CAGGGTAATCTTGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944657596_944657603 0 Left 944657596 2:201891543-201891565 CCTTTGTGGCACAAATTACCTTC 0: 1
1: 0
2: 1
3: 15
4: 96
Right 944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 171
944657592_944657603 26 Left 944657592 2:201891517-201891539 CCTGGGTAAACCAGGATGGTTGG 0: 1
1: 10
2: 54
3: 139
4: 349
Right 944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 171
944657594_944657603 16 Left 944657594 2:201891527-201891549 CCAGGATGGTTGGTCACCTTTGT 0: 1
1: 2
2: 8
3: 40
4: 200
Right 944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944657603 Original CRISPR CAGGGTAATCTTGAGGAGGA AGG Intronic
900393718 1:2444592-2444614 CAGGGTATTCTTTAGGGAGATGG + Intronic
900650315 1:3727191-3727213 CAGGGTGATGATGATGAGGATGG - Exonic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903420359 1:23214635-23214657 CAGGGTGATGTGGTGGAGGAGGG - Intergenic
904357919 1:29953308-29953330 CATGGTAATCTTGGCCAGGAAGG - Intergenic
904459124 1:30664983-30665005 CAAGGTCATCTTGGGGAGAAGGG + Intergenic
904663310 1:32101200-32101222 CAGGGTAAGGCTGAGTAGGAAGG - Intronic
904972796 1:34432262-34432284 CTGGTTAAACTTGAAGAGGAGGG + Intergenic
905871595 1:41407535-41407557 CAGGGTGAACATGAGAAGGATGG - Intergenic
906517004 1:46445540-46445562 CATGGTATTCATGAGAAGGAAGG - Intergenic
907309493 1:53531149-53531171 CAGGTGACCCTTGAGGAGGAAGG + Intronic
907860921 1:58352229-58352251 CAGGTTAATTTAGAGGAGGCAGG - Intronic
908055087 1:60277411-60277433 CAGTGTACTCATGAGGGGGAGGG + Intergenic
912694070 1:111827801-111827823 CAGGGTATCCTGGAGCAGGAGGG - Intronic
915460634 1:156068594-156068616 CTGGGAAATCCTGAGGAAGAGGG - Intronic
917863766 1:179173943-179173965 CAGGGTTTTCTTGAGAAGGTAGG - Intronic
920192678 1:204203518-204203540 CAGGGCAATTCTGAGGAGGAAGG - Intronic
920211302 1:204330803-204330825 CAGGGTGATCTAGGGAAGGAGGG - Intronic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
923019434 1:230151520-230151542 CAGGGCTATCTTGGGGAGGCCGG - Intronic
924588597 1:245381662-245381684 CAGAGTATTCTGGAGGTGGATGG - Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1069048851 10:63771090-63771112 AAGGCTCATCTGGAGGAGGAAGG - Intergenic
1069707052 10:70465531-70465553 CAGGGTTATTTTGACGATGACGG - Intergenic
1070605484 10:77895265-77895287 AAGGGAAATCCTGGGGAGGAAGG - Intronic
1070906313 10:80076514-80076536 CAGGGTAGCCTTGGTGAGGATGG + Intergenic
1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG + Intergenic
1072546369 10:96442505-96442527 CAGGGCAGTCCTGAAGAGGAAGG - Intronic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1073772703 10:106752756-106752778 CAGGGTAATGCTAAGGAGAATGG + Intronic
1074578872 10:114697072-114697094 CAGGGCACTCTGGGGGAGGAAGG + Intergenic
1077913598 11:6595984-6596006 CAAGGTTACCTTGAAGAGGAAGG + Exonic
1078677726 11:13440039-13440061 CAGAGGAATCTTGAAGATGATGG - Intronic
1079622790 11:22574619-22574641 GAGGGTAATTTTGAGTAGAAAGG + Intergenic
1080535901 11:33221355-33221377 GTGGGTAATTTTGAGGAGGAGGG + Intergenic
1082878920 11:58018863-58018885 TTGGTTAATTTTGAGGAGGAGGG + Intergenic
1089022459 11:115230495-115230517 CAGGGTAACTTTGAAAAGGAAGG + Intronic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1092931927 12:13324077-13324099 CAGGGTATTTATGAGGAGGAGGG - Intergenic
1093843296 12:23933216-23933238 CAGGGTTAGCTGGAGCAGGATGG - Intronic
1099720318 12:86353937-86353959 CAAGGTAATCAAGAAGAGGATGG + Intronic
1101062376 12:100985653-100985675 GAGGGTTCTCTTGGGGAGGAGGG + Intronic
1101733265 12:107443949-107443971 CAGGGTCACCTAGATGAGGATGG + Intronic
1104071535 12:125350084-125350106 CAGTGTCCTCTGGAGGAGGAAGG + Exonic
1106483715 13:30155245-30155267 CGGGGTGTCCTTGAGGAGGAGGG - Intergenic
1106869165 13:34000378-34000400 AAAGGAAATCATGAGGAGGAAGG - Intergenic
1107687666 13:42920282-42920304 TAGGGTAATTTTGGGGAGAATGG - Intronic
1110512501 13:76367591-76367613 CAAAGCAATCTTGAGGAAGAAGG + Intergenic
1112481157 13:99776676-99776698 CAGGGAAATTTTGAAGAGGTTGG + Intronic
1113094181 13:106646349-106646371 AAGGGAAATCTTGATGGGGAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1120389957 14:83893838-83893860 CAGGGTGACCTTGAAGAGAATGG - Intergenic
1124655928 15:31507288-31507310 CAGGGTTATATTGAGAAGGTTGG + Intronic
1125183680 15:36906817-36906839 CAGGATAATTTGGAAGAGGAAGG - Intronic
1125601941 15:40920163-40920185 CAGGGTAGTCTGGAGCAGGGAGG - Intergenic
1126269075 15:46791564-46791586 CAGGAAAATCGTGAGGAGGAGGG + Intergenic
1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG + Exonic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1128926013 15:71656894-71656916 CATGATAATGTTGAGGAAGATGG + Intronic
1129654733 15:77516623-77516645 CTGGGGACTCTTGAGGGGGATGG - Intergenic
1130018171 15:80203150-80203172 CAGGGACAGCTTTAGGAGGAGGG + Intergenic
1133526780 16:6613290-6613312 AAGGGTAAACTTGGGAAGGATGG + Intronic
1134384214 16:13756906-13756928 AAGGGTAAACTTGAGGAGGGAGG - Intergenic
1134812458 16:17179223-17179245 CAGGGTCTCCTTGAGGAGGCAGG + Intronic
1135174398 16:20215257-20215279 CAGGGTAGTTCTGGGGAGGAGGG + Intergenic
1138789827 16:59890367-59890389 CAAAGTAATCTTGAGAAAGAAGG - Intergenic
1140978622 16:80084702-80084724 GACGCTAATCTTGAGGAGAAAGG - Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1143167185 17:4902639-4902661 CAGGGTGACCTTGAGGCTGATGG + Exonic
1143286420 17:5793087-5793109 CAGGGTATACTTGGGTAGGAAGG + Intronic
1147176579 17:38659532-38659554 AAGGTTAATGTAGAGGAGGAAGG + Intergenic
1147873113 17:43601788-43601810 CAGGGTAATCGTGAGGAGGCAGG - Intergenic
1150464749 17:65382939-65382961 CAGGGCTATCTTCAGGAGCAGGG + Intergenic
1150510005 17:65741144-65741166 TATGGTAATCTTCATGAGGAAGG - Intronic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1153290152 18:3493034-3493056 CAGGAGCATGTTGAGGAGGAGGG + Intergenic
1155229526 18:23758951-23758973 CATGGTAGGATTGAGGAGGATGG + Intronic
1157897100 18:51479513-51479535 CATGGTCATCTTGAGGTAGAAGG - Intergenic
1158265754 18:55659287-55659309 CAGATTAAACTTCAGGAGGAAGG - Intronic
1160122217 18:76140766-76140788 CAGGGTAATCTTGAGGGATGGGG + Intergenic
1166629904 19:44397397-44397419 TAGGGAAGTCTTGAGGAGGTGGG - Intronic
1166637551 19:44464020-44464042 GAGGGAAGTCTTGAGGAGGTGGG + Intergenic
1168191216 19:54739987-54740009 CAGGGTAGACATGAGGTGGAGGG - Intronic
925119621 2:1407827-1407849 CAGTGTAATCTTGAAGATGTGGG - Intronic
926120716 2:10239925-10239947 CAGGGTGCTGTTGGGGAGGAAGG + Intergenic
926431732 2:12793919-12793941 CAGACTATTCTTGAGTAGGATGG + Intergenic
926760560 2:16275248-16275270 CAGGGGAATTTTGTGGAGGACGG - Intergenic
926855374 2:17250810-17250832 CAGGGTGTGCTTGATGAGGAGGG - Intergenic
929022412 2:37566589-37566611 CATGGTAATTTTGAGCAAGAGGG + Intergenic
931508147 2:62955697-62955719 CATTGTAATCATGGGGAGGAGGG + Intronic
935309053 2:101765030-101765052 CAAGGTAAACTTGAGGATAAAGG + Intronic
938543854 2:132309103-132309125 TAGGGAAGTCTTGAGGAGGTGGG + Intergenic
939507978 2:143072492-143072514 CAGGGAAATGTTGAATAGGAGGG + Intergenic
943483072 2:188446252-188446274 AAGAGTAATCATGTGGAGGATGG + Intronic
943821403 2:192327211-192327233 CAGGGTAATCCTAAGGGGGCAGG + Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
946192287 2:218013916-218013938 CAGGGCAAACTTGGGGAGAAGGG - Intergenic
946423979 2:219582349-219582371 CAGGGCAATCTGGAAGCGGAAGG + Intergenic
947819398 2:233059833-233059855 CAGAGCAAACTTGAGGGGGAGGG - Intergenic
948691283 2:239706691-239706713 GAGGGCACTCTGGAGGAGGAAGG + Intergenic
1169366717 20:4998513-4998535 CAGCTTAACCTGGAGGAGGATGG + Intronic
1171872718 20:30541834-30541856 TAGGGAAGTCTTGAGGAGGTGGG + Intergenic
1172221281 20:33276726-33276748 CAGGGACAGCCTGAGGAGGAGGG + Intronic
1180027457 21:45175928-45175950 CAGGGCGTTCTTGGGGAGGACGG - Exonic
1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG + Exonic
1181893074 22:26081816-26081838 CAGGATAAGCGTGAAGAGGAAGG + Intergenic
1184818138 22:46887910-46887932 CAGTGGAAGCTTAAGGAGGATGG + Intronic
950932406 3:16803606-16803628 CAGAGGAAGCTTGAGGATGAGGG + Intronic
951325186 3:21293707-21293729 CACAGTAGTCTTGAGGGGGAAGG - Intergenic
953704161 3:45218854-45218876 CAAGGTTATTTTGAGGAGGGTGG - Intergenic
954424755 3:50437531-50437553 CAGGGGAATGTTGAGGGGGAGGG - Intronic
955487982 3:59454070-59454092 CAGTTAAATCTTGAAGAGGAAGG + Intergenic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
963112626 3:141699792-141699814 CAGGGTAAGAATGAGTAGGAGGG + Intergenic
964472670 3:157071146-157071168 CAGGATCAGCTTGAGGAAGAGGG - Intergenic
964763798 3:160158935-160158957 CAGGGTATTCTAGGAGAGGAAGG + Intergenic
969347879 4:6580581-6580603 CAGCTGCATCTTGAGGAGGAGGG - Intronic
970498961 4:16657330-16657352 CAGGGTAATAATGATGATGATGG - Intronic
973774948 4:54233728-54233750 CAGGGGAGTGTGGAGGAGGACGG + Intronic
973918400 4:55659885-55659907 CAGGGGACTCTAGAGGAGAATGG - Intergenic
981509572 4:145541109-145541131 CAGGTTAGTGGTGAGGAGGAAGG - Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
986082078 5:4405473-4405495 CAGGGGAAGCTTGAGTAGGGAGG + Intergenic
986757303 5:10850099-10850121 GAGGGTATACTTGAGGAAGATGG + Intergenic
986968418 5:13303219-13303241 CAGGGAAGTCTTAAGGAGGTAGG + Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988501103 5:31784448-31784470 CACAGTGATCTTGTGGAGGATGG + Intronic
989534714 5:42550374-42550396 CAGGGGAACCTTGGGGAGGCAGG - Intronic
991163476 5:63533044-63533066 CAGGGAAAACTAGAGGAGGCTGG - Intergenic
991563375 5:67978901-67978923 CTGGGTAAATTGGAGGAGGAGGG - Intergenic
992603247 5:78426679-78426701 CAGGGAAATTTTGGGAAGGATGG - Intronic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993060499 5:83032898-83032920 CAGGGCAAACTTAAGGAGTAGGG - Intergenic
998694472 5:144623738-144623760 CAGTGTAATATTAAGGAGAAAGG + Intergenic
999380357 5:151117161-151117183 CAGGGGCATCGTGAGGAGGGAGG - Exonic
1002895772 6:1379295-1379317 CAGGGTATTCTGGAGCAGGAGGG + Intergenic
1006382582 6:33708509-33708531 CAGGGTGATCATTAGGACGAAGG + Intronic
1006672378 6:35737394-35737416 CAGGGTGGGCTTGAGGAAGATGG - Intronic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1009404896 6:63300139-63300161 CAGGCAAAGCTGGAGGAGGAAGG - Intronic
1011371367 6:86640404-86640426 CATGATATCCTTGAGGAGGAAGG - Intergenic
1011792463 6:90913425-90913447 CAGGGGGATGGTGAGGAGGAGGG - Intergenic
1013722578 6:113048654-113048676 CAAGTGAATCATGAGGAGGAGGG - Intergenic
1013899001 6:115129779-115129801 CAGGTTTATTTTGAGGAGAAGGG - Intergenic
1014327047 6:120010813-120010835 CAGCGTGATATTGAGTAGGAGGG + Intergenic
1014900997 6:126965269-126965291 CCGGGTAATCTTTAGGACGGTGG + Intergenic
1015118945 6:129680469-129680491 GAGGTTATTATTGAGGAGGAAGG - Intronic
1016120507 6:140337437-140337459 CAGGTGATTCTGGAGGAGGAAGG - Intergenic
1016520213 6:144938497-144938519 CTGGGTAGTATTGAGGAGAAAGG - Intergenic
1017026414 6:150185239-150185261 CAGGGTAGTTGTGAGGATGAAGG + Intronic
1017723409 6:157260045-157260067 GAGGATAATCTGGTGGAGGAAGG - Intergenic
1018202628 6:161409883-161409905 CAGGGTAAACTTTATGAGAATGG - Intronic
1019318918 7:406038-406060 CAGGGTGGTCTGGAGGAGGGAGG - Intergenic
1019951234 7:4374551-4374573 GAGGATGACCTTGAGGAGGAAGG - Intergenic
1021675915 7:23080807-23080829 GAGGGTACTCTTGAGGGGAATGG + Intergenic
1024438285 7:49384853-49384875 CAGAAAAAACTTGAGGAGGAGGG - Intergenic
1030133079 7:106219576-106219598 AAGTGAAATCTTGGGGAGGAAGG - Intergenic
1031956194 7:127944928-127944950 CAGTGTAATCTCTAGGAAGATGG - Intronic
1032374659 7:131399759-131399781 CAGTGTAGTTTTGAGGAGAAGGG + Intronic
1032859822 7:135866319-135866341 CATGGTGATGATGAGGAGGAGGG - Intergenic
1032994775 7:137432815-137432837 CAGGGAAATATTGGGAAGGAAGG - Intronic
1033533642 7:142291304-142291326 CTGGGTAATATTAAGGAAGAAGG - Intergenic
1034243918 7:149630322-149630344 CAGGGCAAGGTTAAGGAGGAAGG - Intergenic
1035693764 8:1577836-1577858 CAGGGGCAGGTTGAGGAGGAAGG - Intronic
1036505538 8:9351842-9351864 CAGGGTATTCTTCAGAATGAAGG - Intergenic
1037981925 8:23260483-23260505 CAGGAAAATCTTGAAGATGAAGG - Intronic
1039623684 8:39025400-39025422 CAGGGTGAACATGAGGAGTAAGG - Intronic
1040717568 8:50275906-50275928 CTGGTTTCTCTTGAGGAGGATGG + Intronic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1051671517 9:19515351-19515373 CAGGGTACTCTGGTGGAGGTGGG + Exonic
1052123408 9:24746207-24746229 CAGGAGAATTTTGAGGAAGAAGG - Intergenic
1054706519 9:68468184-68468206 CCGGGTCTTCTTGAGGAGTAGGG - Intronic
1058850180 9:109004256-109004278 TAGGGTAATGTTTAGGAGTACGG - Intronic
1060404139 9:123364777-123364799 CAGGGTGATGGTGAAGAGGAAGG - Intronic
1061201109 9:129139022-129139044 CAGGATAAGCTGGAGGAGCAGGG + Intronic
1061633784 9:131892045-131892067 CAGGCTAAACTTGAGGAACACGG + Intronic
1188024926 X:25198162-25198184 CAGGGTAGTGTGGAGGAGTAGGG + Intergenic
1189529577 X:41865888-41865910 CTGGGAAACCTTGAGGGGGAGGG + Intronic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1191255203 X:58276689-58276711 CAGGGGAAGGTTGAGGAGGCCGG - Intergenic
1191255306 X:58277090-58277112 CAGGGAAAGGTTGAGGAGGCCGG - Intergenic
1193479225 X:82006864-82006886 CGGGGTATACTTGAGGATGAAGG - Intergenic
1193824093 X:86201274-86201296 CAGGGTCTTCTTGAGGGGGGTGG + Intronic
1198836968 X:140815861-140815883 TAGGGTAATGTTCTGGAGGAAGG + Intergenic