ID: 944658060

View in Genome Browser
Species Human (GRCh38)
Location 2:201896782-201896804
Sequence GTGCAGAAAATCAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 500}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944658060_944658065 14 Left 944658060 2:201896782-201896804 CCATCCTCCCTGATTTTCTGCAC 0: 1
1: 0
2: 3
3: 37
4: 500
Right 944658065 2:201896819-201896841 ACTCTTCTCTATCCCTAAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 122
944658060_944658064 13 Left 944658060 2:201896782-201896804 CCATCCTCCCTGATTTTCTGCAC 0: 1
1: 0
2: 3
3: 37
4: 500
Right 944658064 2:201896818-201896840 AACTCTTCTCTATCCCTAAGTGG 0: 1
1: 1
2: 0
3: 16
4: 1287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944658060 Original CRISPR GTGCAGAAAATCAGGGAGGA TGG (reversed) Intergenic
901190162 1:7405124-7405146 CTGCAGGAAGTGAGGGAGGAGGG - Intronic
901215520 1:7552742-7552764 CTGCAGCAAAGCAGGGAGGCTGG + Intronic
901270020 1:7945001-7945023 GAGCAGGAAATCAAAGAGGAAGG + Intergenic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
903019418 1:20383595-20383617 GCCCAGAGAATCAGGGGGGAGGG + Intergenic
903066030 1:20700015-20700037 GTGCAGAAACTCAGTCTGGAGGG + Intronic
903931179 1:26863408-26863430 GAGCAGAAAAGCAACGAGGAGGG + Exonic
904320093 1:29690940-29690962 TTGCAGAAGATCAGGGTGGCTGG + Intergenic
904909298 1:33922094-33922116 GTGGGGAAGAGCAGGGAGGAAGG - Intronic
905560027 1:38919112-38919134 GAGGAGAAAATGAGAGAGGATGG - Exonic
905654009 1:39674430-39674452 GACCAGAAAACCAGGGAGGCAGG - Intergenic
905851004 1:41274987-41275009 GGGGAGAAAATGAGGAAGGAGGG - Intergenic
905913606 1:41670417-41670439 GTGCATGAATTCAGGGGGGATGG - Intronic
906191245 1:43900820-43900842 GTCCAGAAATTCAGGTAGGTGGG + Intronic
906700110 1:47851464-47851486 GTGAGGAAAAAGAGGGAGGAAGG + Intronic
906720265 1:47998891-47998913 GGGCAGATAGTCAGTGAGGAGGG + Intergenic
907052301 1:51337756-51337778 GGGCAGAAGAACTGGGAGGATGG - Intronic
907861481 1:58357883-58357905 GTGGAGGAAGGCAGGGAGGATGG - Intronic
909043630 1:70684110-70684132 TTTCAAAAAATCAAGGAGGAAGG - Intergenic
909695317 1:78462012-78462034 ATTCTGAAAATCAAGGAGGAGGG - Intronic
909780921 1:79545969-79545991 GTGCAGAAACTGAGGGAAGGAGG - Intergenic
911309139 1:96271344-96271366 ATGCAGAAAATCAGTAAGGGTGG - Intergenic
912552290 1:110492116-110492138 GTGCAAAGAAAAAGGGAGGAGGG - Intergenic
912614393 1:111083491-111083513 TTGCAAAAAGTCAAGGAGGAAGG - Intergenic
912857356 1:113181794-113181816 TTCCAAAAAATCAAGGAGGAGGG + Intergenic
913505982 1:119516588-119516610 AGGCAGAAAAACAAGGAGGAAGG - Intergenic
914217472 1:145645313-145645335 GTGGGAAAAATCAGAGAGGAGGG + Intronic
914470041 1:147967998-147968020 GTGGGAAAAATCAGAGAGGAGGG + Intronic
916158450 1:161882720-161882742 TTGTAGAAAATCAGGTAGCATGG + Intronic
916419284 1:164621281-164621303 GTTAAGAAAATAGGGGAGGAAGG - Intronic
916517301 1:165531716-165531738 GGACAGCCAATCAGGGAGGAGGG - Intergenic
918502935 1:185218224-185218246 GTGTAGAAAATCAGGAAGAGAGG + Intronic
919516741 1:198534289-198534311 GAGCAGACACACAGGGAGGAAGG + Intronic
919984775 1:202665639-202665661 GTGTAGAAAATGAGGAAGTATGG - Intronic
920507995 1:206530664-206530686 GAGTAGAAAAGCAGGGAGGAGGG + Intronic
920603216 1:207350389-207350411 ATGCCAAAAATCAAGGAGGAGGG - Intronic
920688709 1:208129475-208129497 CTGCAGAAATTCTGTGAGGATGG + Intronic
920889668 1:209971920-209971942 TTCCAGAAAAACAAGGAGGAGGG - Intronic
920891999 1:209996563-209996585 TTCCAGGAAATCAAGGAGGAGGG + Intronic
921099565 1:211916583-211916605 GTTCAGAAAATAAAGTAGGAAGG - Intergenic
921255044 1:213331496-213331518 GTGCAGAGACACAGGGATGAAGG + Intergenic
921594920 1:217044304-217044326 GTTGAGAAAATTAGGGAGGCAGG - Intronic
921804807 1:219442165-219442187 GGGGAGAAAAACAGGGAGGAAGG - Intergenic
921969174 1:221126753-221126775 TTCCAAAAAATCAAGGAGGAGGG + Intergenic
923288264 1:232518504-232518526 GCGTAGAAAACAAGGGAGGAGGG - Intronic
923750669 1:236743441-236743463 ATGTAGAAAATCTGGGAGGGAGG + Intronic
924070618 1:240274630-240274652 GTGCAGAATATCAAGAAGAAGGG + Intronic
1063923275 10:10952246-10952268 GTGCGGAACTTCAGGGGGGAAGG - Intergenic
1064886028 10:20113577-20113599 GTGTAGAAAATGAGTAAGGAGGG - Intronic
1065158736 10:22897000-22897022 GGGCAGAAAATTGGGGAAGAGGG - Intergenic
1067367803 10:45651307-45651329 ATGCAGAAAATAGGGTAGGAAGG - Intronic
1067515561 10:46938618-46938640 GGGCAGAGTACCAGGGAGGAGGG - Intronic
1067646690 10:48113197-48113219 GGGCAGAGTACCAGGGAGGAGGG + Intergenic
1068739076 10:60448443-60448465 GAACAGAAAAGCAGGGAGGCTGG + Intronic
1069307465 10:66988844-66988866 GTGGAGAGAAACAGGGAGGAGGG - Intronic
1069356640 10:67594286-67594308 GTTCAAAAAATCGAGGAGGAGGG - Intronic
1069566072 10:69464355-69464377 GTGCTGAAAACCAAGGGGGAAGG + Intronic
1070286507 10:75087546-75087568 GCGCAGAAAATCTCAGAGGAGGG + Intergenic
1070469683 10:76766484-76766506 GTGAAGAAAGGAAGGGAGGAAGG + Intergenic
1070527953 10:77311391-77311413 GTGCCGAGAAGCAGGGAGGAGGG - Intronic
1070768038 10:79067606-79067628 GTGCCGAAAATCAGGGGTGGGGG + Intergenic
1071923967 10:90384187-90384209 TTCCAAAAAATCAAGGAGGAAGG - Intergenic
1073705356 10:105977297-105977319 TTCCAAAAAATCAAGGAGGAGGG - Intergenic
1073857791 10:107697438-107697460 GGGAAGAAAATAAGGAAGGAAGG - Intergenic
1074210187 10:111325064-111325086 TTCCAGAAAATCAAGAAGGATGG + Intergenic
1075908218 10:126101128-126101150 GTCCAGAAATTCATGGAGGCTGG + Exonic
1076175525 10:128364926-128364948 GTGCTGCAATTCAGGGAGGTTGG + Intergenic
1076405172 10:130206952-130206974 CTGCAGAAGACCAGAGAGGAAGG - Intergenic
1078326159 11:10382851-10382873 GAGCTGAAACTCAGGAAGGAAGG - Intronic
1079650863 11:22927463-22927485 ATACAGAAAATCTGGAAGGACGG + Intergenic
1080554530 11:33404116-33404138 TTGCAGAATCTCAGGGAGGGTGG + Intergenic
1080748687 11:35132293-35132315 CTGGAGAAGATCTGGGAGGATGG + Intergenic
1080801621 11:35615458-35615480 GTCCAGAAAATAAAGGAGAATGG + Intergenic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1083194061 11:61072526-61072548 TGGCAGAAGATCAGGGAGGAGGG - Intergenic
1083519372 11:63293836-63293858 TTCCAAAAAATTAGGGAGGAGGG - Intronic
1086431446 11:86740579-86740601 GTTCAGAAAAAAAGGGAGGGGGG + Intergenic
1087288876 11:96298311-96298333 TTGCAGAGAAACAGTGAGGATGG + Intronic
1087522398 11:99257250-99257272 GTGAATAAAACCAGGAAGGAAGG + Intronic
1087855888 11:103091736-103091758 GTCCAGCAAAGGAGGGAGGAGGG + Intronic
1088010651 11:104996788-104996810 GTGGAGAAAATAAAGTAGGAAGG + Intronic
1088965578 11:114717748-114717770 GTCGAGAAGATGAGGGAGGAGGG - Intergenic
1089119077 11:116119113-116119135 GTGAGAAAAATCAGGGAGAAGGG - Intergenic
1089942207 11:122430618-122430640 GTGCTGAAATGCAGGGAGCAGGG - Intergenic
1090187778 11:124749533-124749555 CTGCAGAAAGACAGGCAGGAGGG + Intronic
1091305311 11:134532582-134532604 GGGCAGAAAGTCAGGGTGCAAGG + Intergenic
1092406177 12:8223581-8223603 CTGGGGAAAACCAGGGAGGACGG - Intronic
1092642875 12:10536650-10536672 CTACAAAAAATCAAGGAGGAGGG + Intergenic
1093275056 12:17115826-17115848 TTCCAAAAAATCAAGGAGGAAGG - Intergenic
1093603507 12:21060756-21060778 TTCCAAAAAATCAGGAAGGAAGG - Intronic
1093933816 12:24980388-24980410 CTACAGAAAATCATAGAGGAAGG + Intergenic
1098201935 12:68065040-68065062 TTTCAAAAAATCAAGGAGGAGGG - Intergenic
1098399573 12:70059530-70059552 TTCCAAAAAATCAAGGAGGAGGG + Intergenic
1098428678 12:70395091-70395113 GTTCAGAAAATGAGGGATTATGG + Intronic
1098814186 12:75136783-75136805 TTCCAAAAAATCAAGGAGGAGGG + Intronic
1099644232 12:85330426-85330448 GTGGAGAAAGGGAGGGAGGAAGG - Intergenic
1100386214 12:94106405-94106427 GTGCAAGAAAGCAGGGAAGAGGG - Intergenic
1100742898 12:97614811-97614833 GTGCAAAAAAGAAGGAAGGAAGG - Intergenic
1101858609 12:108464492-108464514 GAGAAGAAAGGCAGGGAGGATGG + Intergenic
1102099745 12:110269340-110269362 GTGCAGATAAAAAGGAAGGAAGG - Intergenic
1102219036 12:111182005-111182027 GTGCACCTAATCTGGGAGGAGGG + Intronic
1102768425 12:115452483-115452505 GTGGAGAGAATCAGAGAGGTGGG - Intergenic
1102840050 12:116109388-116109410 GAGCAGAAAAACTGGGAGGGAGG - Intronic
1103363319 12:120366789-120366811 GGGAAGAGAATGAGGGAGGAAGG - Intronic
1103845935 12:123902149-123902171 GTGCAGACACACAGGGAAGAGGG - Intronic
1103938389 12:124488781-124488803 GGGCAGAGAAGCAGGGCGGACGG + Intronic
1103970302 12:124666652-124666674 GAGCAGAGAAGCAGGAAGGATGG + Intergenic
1105709703 13:22995322-22995344 GTGAAGGAAATGAGGGAGGGAGG + Intergenic
1106072873 13:26430296-26430318 TTCCAAAAAATCAAGGAGGAGGG + Intergenic
1106822614 13:33482925-33482947 AAGCAGAAAATCAGGTAGGAGGG + Intergenic
1107402058 13:40078710-40078732 GTCCAGAGAATCATGGAGAATGG - Intergenic
1108346616 13:49552689-49552711 CTGCAGAACAGCAAGGAGGAAGG + Intronic
1109691633 13:65899978-65900000 TTCCAAAAAATCAGAGAGGAAGG - Intergenic
1110317340 13:74125399-74125421 GAGCTGAAAATCAAGGAGGGTGG - Intronic
1110336772 13:74341745-74341767 TTCCAAAAAATCAAGGAGGAGGG - Intergenic
1110522563 13:76498106-76498128 GTGCAGAAATAGAGGAAGGAAGG + Intergenic
1110782166 13:79479206-79479228 GTTCAGAGAATCTGGGAGGAGGG + Intergenic
1110803634 13:79729687-79729709 TTGCAAACAATCAAGGAGGAGGG - Intergenic
1111647701 13:91051449-91051471 GTGAAGGAAAGCAGGGAAGAGGG - Intergenic
1111986659 13:95072749-95072771 GTGAAGAACAGAAGGGAGGAAGG - Intronic
1112835725 13:103512010-103512032 GTACTGAAGAACAGGGAGGAAGG + Intergenic
1112921842 13:104622970-104622992 GTGCAGTAAAGTAGGGAAGAGGG - Intergenic
1114479241 14:23021643-23021665 GGGCAGAAAAACAGGGAGGAAGG - Intronic
1115445260 14:33482656-33482678 TGGCAGAAGAACAGGGAGGAAGG - Intronic
1116109421 14:40558249-40558271 GTGAAGAAAAGGAGGGTGGAAGG - Intergenic
1116734719 14:48674416-48674438 TTCCAAAAAATCAAGGAGGAGGG + Intergenic
1117376462 14:55122616-55122638 GTGCAGAAAATCAGGGAACGTGG - Intergenic
1117434607 14:55703954-55703976 TTGAAGGAAATCAGGCAGGAGGG - Intergenic
1117661656 14:58012556-58012578 GGGCAGAGATTAAGGGAGGAAGG + Intronic
1118226604 14:63906339-63906361 TTCCAAAAAATCAAGGAGGAGGG - Intronic
1118348074 14:64954234-64954256 GTGAAGAGAAGGAGGGAGGAAGG + Intronic
1119001313 14:70884515-70884537 GAGCAGAAAATCACAGAGAAAGG + Intergenic
1119133997 14:72200309-72200331 GTTCCGAAAAGCAGGGCGGACGG - Intronic
1120573673 14:86153629-86153651 GTGCAGGAAATAAGAAAGGAAGG - Intergenic
1120594163 14:86413629-86413651 GTGCAGGAGAGCGGGGAGGATGG - Intergenic
1121021006 14:90580088-90580110 GTGCAGAAAATCAGAGCACAGGG - Intronic
1121052710 14:90829968-90829990 GTGCACACATTCTGGGAGGAAGG - Intergenic
1121062372 14:90925143-90925165 GTACAGAAAACCAGAGAGGTAGG + Intronic
1121456274 14:94040818-94040840 GTGGGAAAAATCAGGCAGGAAGG + Intronic
1121638332 14:95468646-95468668 GGCCAGAAGAGCAGGGAGGAAGG - Intronic
1121904631 14:97728408-97728430 GTCCAGAAAAGCAGAAAGGAAGG + Intergenic
1121967874 14:98327042-98327064 ATGCAGAGAATCAGGGATGTAGG + Intergenic
1126475291 15:49059472-49059494 GTGAACAAAGTCAGGGAGGTGGG - Intergenic
1126958436 15:53961311-53961333 GTGAAGCAATTCAGAGAGGAGGG - Intergenic
1127796203 15:62440537-62440559 GTGCCAAACGTCAGGGAGGACGG + Intronic
1127899084 15:63328004-63328026 GTACAGAGAAGCAGAGAGGACGG + Intronic
1127964672 15:63914658-63914680 AGGTAGAAAATCAGGGTGGAGGG - Intronic
1128597163 15:68963560-68963582 ATTCACAAAATCAGAGAGGAGGG - Intronic
1129165244 15:73773574-73773596 AGGCAGAAAAGGAGGGAGGAGGG - Intergenic
1130118258 15:81024359-81024381 GTGCTGACAATGAGGGAGGAGGG + Intronic
1130667287 15:85880342-85880364 GTGAAGGAAATGAGGAAGGAAGG + Intergenic
1131197086 15:90364306-90364328 GGGCAGGAAGACAGGGAGGAGGG - Intronic
1132259859 15:100414050-100414072 TTCCAAAAAATCAAGGAGGAGGG + Intronic
1132382829 15:101378685-101378707 GTAGAGAACATCAGGGAAGAGGG - Intronic
1133958515 16:10469502-10469524 TTGCTGAAAGTCAGTGAGGAAGG + Intronic
1134528077 16:14960039-14960061 GAAAAGAAAATCAGGAAGGAGGG - Intergenic
1135172301 16:20196140-20196162 TTGCAGAAAATAAAAGAGGAAGG - Intergenic
1135732531 16:24906926-24906948 AGGCAGAACCTCAGGGAGGACGG - Intronic
1136067513 16:27768828-27768850 CTGCAGAAAGGAAGGGAGGAAGG - Intronic
1136395292 16:29989051-29989073 GTCCAGCAGCTCAGGGAGGAAGG - Intronic
1137504494 16:49041327-49041349 GAGCAGAAGCCCAGGGAGGAAGG + Intergenic
1137613787 16:49835440-49835462 GTGCAAAATAAAAGGGAGGAAGG + Intronic
1138350987 16:56346100-56346122 GTGCAAGAAACCAAGGAGGATGG - Exonic
1138468482 16:57211915-57211937 GTGCAGAAAAACATTGTGGACGG + Intronic
1138898389 16:61238267-61238289 GGGCAGAAAAGCAGGCACGATGG - Intergenic
1139496029 16:67318697-67318719 TTGCAGAAAATCAGAGATCAAGG - Intronic
1139605361 16:68014330-68014352 GTGGAGAAACTCAGGTAGGCTGG - Intronic
1139661068 16:68421231-68421253 GTGAAGCAGATGAGGGAGGATGG - Intronic
1139678555 16:68541988-68542010 CTGCAGATAACCAGGGATGAAGG + Intronic
1141797873 16:86286899-86286921 GGGCAGAAAGACAGGGAGGCGGG - Intergenic
1143263017 17:5614312-5614334 GTCCAGAAAAACAGAGAGCAGGG - Intronic
1143272613 17:5686971-5686993 GTGCAGATGCTCAGAGAGGAAGG + Intergenic
1146962022 17:36989196-36989218 ATGCAGAAAATCAGTGCTGAAGG - Intronic
1147015920 17:37490972-37490994 CTGTAGAATGTCAGGGAGGACGG - Intronic
1147118484 17:38320785-38320807 GTGAAAAAAAGCTGGGAGGAAGG - Intronic
1147920699 17:43915217-43915239 GTGCAGAATCTCTGGGAGGCAGG + Intergenic
1147969486 17:44211951-44211973 GAGCTGAACATCAGTGAGGAGGG - Exonic
1148150308 17:45393131-45393153 GCCCAGAAAACCAGGGAGCATGG - Intergenic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1148866134 17:50629693-50629715 GTGGAGAAAATGAAGGAGGCTGG + Intergenic
1149194698 17:54105477-54105499 GTTCAAAAAATCAAGGAGGAGGG + Intergenic
1149655455 17:58307538-58307560 GTGGAGGAAAGGAGGGAGGAGGG + Intronic
1150658683 17:67057136-67057158 GTGAAGAACATCAGGAAGCAGGG + Intergenic
1151702942 17:75752981-75753003 GTGCTGGGAATCAAGGAGGAAGG - Intronic
1151870353 17:76832661-76832683 GTGCAGAAGATGATGGAGGAAGG - Intergenic
1153616333 18:6938095-6938117 GGGCAGAACATCACGGAGGCAGG + Intergenic
1155283606 18:24266214-24266236 GTGGGGAAAGCCAGGGAGGAAGG - Intronic
1156268496 18:35509704-35509726 TTCCAGAAAATCAAAGAGGAGGG - Intergenic
1156395149 18:36692730-36692752 GTTCAGAAATTCAGAGAGGCAGG + Intronic
1156926949 18:42593697-42593719 TTCCAAAAAATCAAGGAGGAGGG - Intergenic
1157226150 18:45866500-45866522 CAGCAGAATAGCAGGGAGGAAGG - Intronic
1157483958 18:48073811-48073833 GTGCAGAAACTCGGGGAGCAAGG - Intronic
1157743081 18:50110364-50110386 CTGGAGCAAATGAGGGAGGAAGG - Intronic
1158352144 18:56573774-56573796 GGGCATAGATTCAGGGAGGACGG + Intergenic
1159227703 18:65561573-65561595 GTGCAGAAATTCAGGGATGTTGG + Intergenic
1159743040 18:72197038-72197060 ATGCAGAAAAGCGGGGATGAAGG + Intergenic
1160208589 18:76858081-76858103 GCATAGAGAATCAGGGAGGATGG - Intronic
1160346878 18:78139511-78139533 GAGCAGAAAAGCAGGAGGGAGGG - Intergenic
1160757479 19:765194-765216 GAGCAGAGACTGAGGGAGGAGGG + Intergenic
1161001722 19:1914171-1914193 GGGCAGGAAGTCAGGGAGGAGGG + Intronic
1162172833 19:8804835-8804857 GTGCAGAAAATGTTGGGGGAAGG + Intergenic
1162320625 19:9969177-9969199 GTGTAGACCATCAGGGTGGAAGG + Intronic
1163002753 19:14379024-14379046 CTGCAGAATCTCAGGGAGGCAGG - Intergenic
1163563115 19:18032697-18032719 GTGTAGAAAGTCTGGGAGGGGGG - Intergenic
1164763080 19:30742887-30742909 GTGGGGGAAATCAGGGAGCAAGG - Intergenic
1164905189 19:31961374-31961396 GTGCACAGAAGAAGGGAGGAGGG - Intergenic
1165174871 19:33921388-33921410 GTCAAGTACATCAGGGAGGAAGG - Intergenic
1165375054 19:35435980-35436002 GAGCAGAAAAACAGGGGGCAGGG - Intergenic
1166563365 19:43747953-43747975 GAGCAGAGAAGGAGGGAGGAGGG - Intronic
1167596887 19:50432651-50432673 CTCCAGAATCTCAGGGAGGAGGG - Intergenic
925100498 2:1240325-1240347 GAGCAGAAAATCAGGCCTGAGGG - Intronic
925518625 2:4714841-4714863 GCAGGGAAAATCAGGGAGGAGGG - Intergenic
925622583 2:5808158-5808180 GTGCAGTAAGCCAGGGAAGATGG - Intergenic
925672070 2:6321258-6321280 TTTCAAAAAATCAAGGAGGAAGG + Intergenic
926230820 2:11002633-11002655 GTGCAGAAAGGGAGTGAGGAAGG + Intergenic
927033293 2:19144994-19145016 GTGAACAAATTCAGGTAGGAAGG - Intergenic
927464015 2:23323690-23323712 CTGCAGAGGAACAGGGAGGAAGG + Intergenic
927515257 2:23668536-23668558 CTGCAGAAGTCCAGGGAGGAGGG + Intronic
928080258 2:28305570-28305592 TTTCAGAAAACAAGGGAGGAAGG - Intronic
928239071 2:29570973-29570995 GAGCAGAGACTCAGGGAGAAAGG + Intronic
928337848 2:30413452-30413474 GAGGAGGAAACCAGGGAGGAGGG - Intergenic
928907942 2:36387890-36387912 GTCCAAAGAATCAAGGAGGATGG - Intronic
929727791 2:44448972-44448994 GTGCAGGAAACTAGGGAGTATGG + Intronic
929900863 2:46002291-46002313 GGGCAGAAAATCCGGGTGAAGGG + Intronic
929977310 2:46647379-46647401 GTGCAGAAAGGGAGGGGGGAAGG - Intergenic
930026066 2:47029848-47029870 ATGCAGTAAATGAGGGAGGTGGG - Intronic
930886148 2:56329101-56329123 GTGAAGGAAATGAGGGGGGAAGG - Intronic
930912922 2:56651779-56651801 GTACATGAAATCATGGAGGAAGG + Intergenic
931015843 2:57979573-57979595 TTCCAAAAAATCAAGGAGGAGGG - Intronic
931439280 2:62276562-62276584 TTGCAGAAAAGCATGGGGGATGG - Intergenic
931686649 2:64799821-64799843 GTACAGAAGATGATGGAGGAGGG - Intergenic
932045240 2:68341866-68341888 GGGCGGAATATCAGTGAGGAAGG + Intergenic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
932867907 2:75365673-75365695 GTCAAAAAAATCAGGGAGAAAGG - Intergenic
932884528 2:75536914-75536936 TTCCAGAAAATCAGAGAAGAGGG + Intronic
933250799 2:80026225-80026247 TTGCAGAAAAACAGAGAGGCCGG + Intronic
936236022 2:110743546-110743568 GTTCAGAGACTCAGGGAGGAGGG + Intronic
936514534 2:113173636-113173658 GGGCAGAAGCGCAGGGAGGAAGG + Intronic
936705189 2:115064333-115064355 GTACAGCAAAGCAGGGAAGAAGG + Intronic
936997867 2:118434103-118434125 GTCCACAAAATGAGGGAGGTGGG + Intergenic
937350034 2:121154869-121154891 GTGCAGAAAATAGGGGAGCTTGG + Intergenic
937440956 2:121915637-121915659 CTTCAGAAAATGAGGGGGGATGG + Intergenic
937605058 2:123790109-123790131 GGGTAGAAAATCAGGAAGTATGG + Intergenic
937669966 2:124528046-124528068 CTGCAGAAAACCAAAGAGGATGG + Intronic
938894206 2:135734554-135734576 ATGCTAAAAATCAGGGAAGATGG + Intergenic
938965164 2:136381703-136381725 GTGGAGAAAAGTAGGGAGGCAGG + Intergenic
941766055 2:169297723-169297745 GTTTACATAATCAGGGAGGAGGG + Intronic
942128578 2:172853173-172853195 CTTCAGAAAATGAAGGAGGATGG - Intronic
942536531 2:176970200-176970222 GTGCAGTAAAACAGGCTGGAGGG - Intergenic
942841879 2:180371804-180371826 GTGCAGAAACTCAGAGAGGCAGG - Intergenic
943246161 2:185453563-185453585 TTGCAAAAAATTAAGGAGGAGGG + Intergenic
943616876 2:190102799-190102821 TTCCAAAAAATCAAGGAGGAAGG + Intronic
944051816 2:195478597-195478619 GTGCAAAAAATTAGGCAAGAGGG + Intergenic
944640521 2:201720069-201720091 TTTCAGAAAATAGGGGAGGAGGG + Intronic
944652679 2:201847457-201847479 CTGGAGAAAATCTGGGAGGTAGG + Exonic
944658060 2:201896782-201896804 GTGCAGAAAATCAGGGAGGATGG - Intergenic
944893655 2:204142650-204142672 CAGCAGAGGATCAGGGAGGAGGG - Intergenic
945024695 2:205608882-205608904 GTACAGAAAATGAAGGAGAAAGG - Intronic
945498729 2:210542011-210542033 GATCAAAAAATAAGGGAGGAGGG - Intronic
946373410 2:219294321-219294343 GTGGAGAAAAACAGGGGAGAGGG + Intronic
946451372 2:219782872-219782894 GTGCAGAGGATCAGGGGAGAGGG + Intergenic
946536612 2:220636580-220636602 GTGCAGAAATCTAGGGAGGTGGG + Intergenic
946822626 2:223646150-223646172 GAGCAGAAAAGCAGGGGGAAAGG + Intergenic
946953607 2:224904976-224904998 GTGAAGAAAATTACAGAGGAGGG - Intronic
947702484 2:232246130-232246152 CAGCAGAAGAGCAGGGAGGATGG + Intronic
947761015 2:232604076-232604098 GGGAAGAAAATCAAGAAGGAAGG - Intergenic
948189119 2:236044791-236044813 GGGCAGAACAGCAGGGAGTAGGG - Intronic
948540140 2:238685445-238685467 GTGCACACTACCAGGGAGGATGG - Intergenic
1168900285 20:1358193-1358215 GGGCAGAATAACAGAGAGGAGGG - Intronic
1169566943 20:6865032-6865054 ATGGAGAAAATCATAGAGGACGG + Intergenic
1169689580 20:8315591-8315613 ATGTATAAAATGAGGGAGGAAGG + Intronic
1170480745 20:16762540-16762562 GTGCTTAAAATCATGGAGAAAGG - Intronic
1170540384 20:17381753-17381775 GTGGAGAAAAAAAGGGAGGGTGG - Intronic
1170754979 20:19194086-19194108 GTGCTTAAAATCAGGGAGACAGG - Intergenic
1171139678 20:22729919-22729941 GTGTGGAAAGTCATGGAGGAGGG + Intergenic
1172729728 20:37076007-37076029 GTGGAGAAAAACTGGGAGGCAGG - Intronic
1173597993 20:44272148-44272170 GTGCAGAACAACATGGAGAAGGG + Intronic
1174026563 20:47581388-47581410 GGGGAGAAAATCAGTGAGCAGGG - Intronic
1174338564 20:49882224-49882246 GTGGAGAAAATGAGCGAGCACGG - Intronic
1174561078 20:51431323-51431345 GTCCAGGATCTCAGGGAGGAAGG - Intronic
1174578889 20:51556917-51556939 GTGCAGAAAGTCAAGCAGGAAGG + Intronic
1174686037 20:52456402-52456424 GATCAGAAAATCAGGGAGGTTGG - Intergenic
1174764004 20:53234748-53234770 GAGCAGAAAATCCAGGAAGAGGG + Intronic
1174908417 20:54577768-54577790 GTTCAGAAATCCAGGAAGGAGGG + Intronic
1175467937 20:59205230-59205252 GTGCAGAGACAAAGGGAGGAAGG - Intronic
1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG + Intronic
1176073084 20:63236786-63236808 GTGCAGAACAGCAGCGGGGAAGG - Intronic
1176888946 21:14290990-14291012 GAGCAGAAAAACAGTGGGGATGG - Intergenic
1176890686 21:14314778-14314800 GTGCAGCAAGACAGGAAGGAGGG + Intergenic
1178047979 21:28717149-28717171 TTCCAAAAAATCAAGGAGGAGGG - Intergenic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1178529145 21:33360508-33360530 ATCCAGAAAATCTGGGAGGGAGG - Intergenic
1179276540 21:39897068-39897090 ATGAAGAAAATGAGGGAGGTAGG - Intronic
1179339176 21:40488250-40488272 AAGCAGAAACTCAGAGAGGAAGG - Intronic
1179589241 21:42395160-42395182 CTGCAGAATCTCAGGGAGAAGGG - Intronic
1180571944 22:16732313-16732335 GAGATGAGAATCAGGGAGGAAGG + Intergenic
1181779536 22:25182770-25182792 GTGCTGAACATCAGGGAAGCAGG + Intronic
1182036435 22:27202256-27202278 GTGAACTAAATCAGGAAGGAGGG - Intergenic
1182045907 22:27273989-27274011 GTGCAGAAAATCTGAATGGAAGG - Intergenic
1182083184 22:27543521-27543543 GAGCAGAGAAACAGGGAGGAGGG - Intergenic
1182454090 22:30438778-30438800 GAGCAGGAACTGAGGGAGGAGGG - Intergenic
1182567858 22:31212986-31213008 TTGCAGAAAATAAGGGAGTATGG + Intronic
1184730283 22:46367903-46367925 GTGCAGAGAGGGAGGGAGGAAGG - Intronic
950205455 3:11076804-11076826 CTGAAGCAGATCAGGGAGGAAGG - Intergenic
950209952 3:11115908-11115930 GGGCAGAATACCAGGGAGGAGGG - Intergenic
950579652 3:13853932-13853954 GACCACAAAAACAGGGAGGAGGG + Intronic
952069458 3:29616619-29616641 CTACAGCACATCAGGGAGGAAGG - Intronic
953178495 3:40574251-40574273 GCACAGAGAATGAGGGAGGAGGG + Intronic
953198679 3:40756968-40756990 GTGGAGCAGAGCAGGGAGGAGGG + Intergenic
953744676 3:45565227-45565249 GTGATGAAAATGAGGGTGGATGG + Intronic
954425068 3:50438848-50438870 GTGGGGAAAAGCAAGGAGGAAGG + Intronic
955192408 3:56773660-56773682 TTGCAGAAAATCATGGTGTACGG - Intronic
955804968 3:62724236-62724258 GAGGAAAAAATCAGGGAGGAGGG - Intronic
956634058 3:71345753-71345775 GTGCAGAAATTCAGTGCAGATGG + Intronic
956654612 3:71536896-71536918 GTGCAGAATAGCAGCGATGACGG + Intronic
957106245 3:75892092-75892114 GAGATGAGAATCAGGGAGGAAGG - Intergenic
957652651 3:83028962-83028984 TTCCAAAAAATCAAGGAGGAGGG + Intergenic
957873394 3:86114817-86114839 GGGCAGAAAATCAAGGTGGATGG + Intergenic
958769117 3:98405619-98405641 GTGCAAAAAATCAAGGAGGAGGG + Intergenic
959201113 3:103248983-103249005 CTGCAGACAATCAGGGATAATGG + Intergenic
959217550 3:103471598-103471620 GAGCAGAAAATCACTTAGGAAGG - Intergenic
959397624 3:105860830-105860852 GTGCAGAAAAGCAGGAAATAAGG + Intronic
960068206 3:113398282-113398304 GGGAAGAAAATCACAGAGGAAGG + Intronic
960342474 3:116490734-116490756 TTCCAAAAAATCAAGGAGGAAGG + Intronic
961982957 3:131100776-131100798 TTCCAAAAAATCAAGGAGGAGGG - Intronic
962450984 3:135516794-135516816 GAGCAGAAAATCTGGTAGAATGG + Intergenic
963306212 3:143656153-143656175 GTGCAGAATATCTTGGAGGCAGG + Intronic
964571097 3:158107462-158107484 GTGCAGAGAGTAAGGGAGAAGGG - Intronic
965762969 3:172099648-172099670 GAGCAGAAAAGCAGGCTGGAGGG - Intronic
966024777 3:175263747-175263769 ATGAAGAAAAGAAGGGAGGAAGG + Intronic
966482319 3:180424664-180424686 GGGCAGAATATCACGGAGGCAGG - Intergenic
967442305 3:189522809-189522831 TTCCAGAACATCAAGGAGGAGGG + Intergenic
968285833 3:197508253-197508275 ATGCGGAAAATCAGGGCAGATGG - Intergenic
968441703 4:627696-627718 TGGCAGAAAAGGAGGGAGGAGGG - Intronic
968624191 4:1619142-1619164 GTGCTGGAGCTCAGGGAGGATGG - Intronic
968933236 4:3595478-3595500 GGGCAGAGGATCAGAGAGGAGGG - Intergenic
970689943 4:18611510-18611532 AGGAAGAAAATGAGGGAGGAAGG + Intergenic
970887623 4:21004770-21004792 GTACAGAAGATCAGTAAGGATGG + Intronic
971709681 4:30094377-30094399 AGGAAGAAAATGAGGGAGGAAGG + Intergenic
971858148 4:32070018-32070040 GTTCAAAAAATCAAGGAAGAGGG - Intergenic
972070724 4:35017240-35017262 TTCCAAAAAATTAGGGAGGAAGG + Intergenic
972296775 4:37746571-37746593 GCACAGAAAATCTGGGAAGAGGG + Intergenic
972994824 4:44867389-44867411 TTCCAAAAACTCAGGGAGGAGGG - Intergenic
974205312 4:58695197-58695219 GGCCATAAAATCATGGAGGAAGG - Intergenic
975090870 4:70402651-70402673 ATGCAGAAAATTTGGGAAGAAGG + Intronic
975746123 4:77476407-77476429 TTTCAAAAAATCAAGGAGGAGGG + Intergenic
975820117 4:78262261-78262283 GTGATGAAAAGCAGTGAGGAAGG - Intronic
976015332 4:80545701-80545723 TTGCAAAAAATCAAGGAGGAGGG + Intronic
976194621 4:82520937-82520959 GTGCGTAAAGTCAGAGAGGAAGG - Intronic
976459164 4:85287853-85287875 TTTCAAAAAATCAAGGAGGAAGG - Intergenic
977052497 4:92147351-92147373 CTCCAGAAAATCAAGAAGGAGGG + Intergenic
977933236 4:102771586-102771608 TTCAAGGAAATCAGGGAGGAGGG + Intergenic
978192505 4:105931113-105931135 GTACAGAAACTCAAGGAGGAGGG - Intronic
978856162 4:113397286-113397308 GTGAGCAAAACCAGGGAGGAGGG + Intergenic
979192343 4:117877233-117877255 GTGAAGGAAATTAGGGATGATGG - Intergenic
979580505 4:122353134-122353156 GCTCAGAAAATCTGGGAAGATGG + Exonic
979662826 4:123278008-123278030 TTCCAAAAAATTAGGGAGGAGGG - Intronic
979838192 4:125401015-125401037 GTGTAGAAAGGCAGAGAGGATGG + Intronic
980088091 4:128412741-128412763 TTCCAAAAAATCAAGGAGGAGGG - Intergenic
981525036 4:145700285-145700307 CTCCAGAAAAGCAGGGAGGGGGG - Intronic
982085351 4:151829955-151829977 CTGCAAAAAAGCAGCGAGGAAGG + Intergenic
982349150 4:154395774-154395796 GTGGAGAAAAGCAGGCAAGAAGG + Intronic
983627521 4:169816570-169816592 GAGAAGGACATCAGGGAGGAAGG + Intergenic
984524077 4:180836007-180836029 GTGGAGCAAAACTGGGAGGAGGG - Intergenic
985095594 4:186409507-186409529 GGGGAGGAAATGAGGGAGGAGGG + Intergenic
985364746 4:189216503-189216525 GTGCAAACAATCATGGAGAAAGG + Intergenic
985926138 5:3020606-3020628 GTGCAGAAAAGCAGAAGGGAAGG + Intergenic
986021535 5:3808984-3809006 GTACAGAAAATCAGAGGGGTGGG + Intergenic
986269591 5:6219094-6219116 CGGCACAAAATCAGGTAGGAGGG + Intergenic
986370862 5:7078637-7078659 GAGCATACAATCTGGGAGGAAGG - Intergenic
986472649 5:8091362-8091384 GTGTTGAAAATGAGGAAGGAGGG + Intergenic
986576111 5:9214387-9214409 GTGCAGAGGATCAGGGGGAAGGG + Intronic
987177702 5:15333339-15333361 TTCCAAAAAATCAAGGAGGAGGG + Intergenic
988125658 5:27030476-27030498 AAGCAGAAAAGCAGGGGGGATGG + Intronic
990310540 5:54533882-54533904 GTGGAGACCAACAGGGAGGAAGG + Intronic
991035403 5:62123074-62123096 GTGGAGAAGATCAGGATGGAGGG + Intergenic
991055531 5:62315633-62315655 ATGAAGAAGATAAGGGAGGAGGG + Intronic
994090966 5:95809237-95809259 GTGTAGTAAATTAGGGAGCATGG + Intronic
994491806 5:100456915-100456937 GTAGAGAAAAACAGGGAGAATGG - Intergenic
995114249 5:108461232-108461254 CTGGAGAAAAGCAGGTAGGAGGG - Intergenic
995388094 5:111610464-111610486 TTCCAAAAAATCAAGGAGGAGGG - Intergenic
995484668 5:112628305-112628327 GTGCTGAAAAGGAGGGAGGGAGG - Intergenic
996456171 5:123684980-123685002 TTCCAAAAAATCAAGGAGGAAGG + Intergenic
997379127 5:133422624-133422646 GTGGGGAAAATCAAGGAGGGAGG + Intronic
997775930 5:136604996-136605018 GAGCAGAAAAAGAGGAAGGAAGG - Intergenic
998056752 5:139085174-139085196 ATGAACAAAAACAGGGAGGAAGG + Intronic
998365729 5:141629579-141629601 GAGAAGCTAATCAGGGAGGAGGG + Intronic
999078121 5:148816803-148816825 GTGCAGGAAATGAGGAAAGAAGG + Intergenic
999372184 5:151062663-151062685 CTGCAGGAAGTCAGGGAGGGAGG - Intronic
999644968 5:153708463-153708485 TTTATGAAAATCAGGGAGGAGGG - Intronic
1000380301 5:160622860-160622882 GTGCAGAAATTCAGGATTGAGGG - Intronic
1000825130 5:166035208-166035230 GTGCAGAAATGCAGGCAAGAAGG - Intergenic
1001234379 5:170017223-170017245 GTGCAGAAACTCAGGTGGTATGG - Intronic
1001334488 5:170785988-170786010 ATGCAAAAGAGCAGGGAGGATGG - Intronic
1001428586 5:171641976-171641998 GTGCAAACAGTCAGGGAAGAGGG + Intergenic
1002658759 5:180775543-180775565 ATGAAAAAAATCAGGAAGGATGG - Intergenic
1003912859 6:10758474-10758496 TTGCAGAGAAGCAGGGATGAGGG - Intronic
1003950857 6:11114371-11114393 CTCCAAAAGATCAGGGAGGAAGG - Intronic
1004533672 6:16478362-16478384 TTCCTGAAAATTAGGGAGGAAGG + Intronic
1005298795 6:24451113-24451135 GTGCAGAAAGTCCTGTAGGACGG + Intronic
1005840737 6:29743274-29743296 GCACAGAAACTCAGGGAGGCAGG + Intergenic
1006022538 6:31125962-31125984 GGGCAGGAAACCAGAGAGGAGGG - Intronic
1006102395 6:31693597-31693619 GACCAGAAAATCAGGGGAGATGG + Intronic
1006456449 6:34134676-34134698 ATGAAGAAAGTCAGGGAGGGAGG - Intronic
1006672829 6:35740279-35740301 CAGCAGGAAAGCAGGGAGGATGG - Intronic
1006947039 6:37791540-37791562 GTGCAGAGTTACAGGGAGGAGGG + Intergenic
1007378018 6:41469533-41469555 CTGCAGTCACTCAGGGAGGAGGG + Intergenic
1008008023 6:46433149-46433171 ATGCTGAAAATCAGGCAGTAGGG + Intronic
1008966607 6:57319167-57319189 GTTCAGGAATTCAGGGTGGATGG + Intronic
1009849405 6:69176661-69176683 TTGCAAAAAATCAAGGAGGAAGG - Intronic
1009932531 6:70193401-70193423 GGGCAGGAACTCAGAGAGGAAGG - Intronic
1010087151 6:71934083-71934105 GTGCAGAAGATCCGGGATGTGGG + Intronic
1010133040 6:72517792-72517814 GATTAGAAAATCAGGGTGGATGG - Intergenic
1010456962 6:76067644-76067666 TTTCAAAAAATCAAGGAGGAGGG + Intronic
1010679188 6:78780441-78780463 ATGCAGGCAATCATGGAGGATGG + Intergenic
1010706713 6:79121880-79121902 GTCCAGAAAATAAGAGAGAAGGG + Intergenic
1011630420 6:89318042-89318064 TTCCAAAAAATCAAGGAGGAGGG + Intergenic
1012448977 6:99334940-99334962 GTGCATAAAGTCAGGGAGGTGGG - Intronic
1012870426 6:104666765-104666787 TTCCAAAAAATCAAGGAGGAGGG + Intergenic
1013207825 6:107960060-107960082 GTGCAGAAAAAAAGTGAGGAGGG - Intergenic
1013581937 6:111543880-111543902 ATTCAAAAAAGCAGGGAGGAAGG - Intergenic
1013633094 6:112003814-112003836 GGGGAGAAAAACAGGGAGGGAGG + Intergenic
1014112118 6:117630055-117630077 GTGCAGAAAGTTAGAGAGCAAGG - Intergenic
1015310214 6:131758654-131758676 CTGCAGAAAATATGGGAGGGAGG - Intergenic
1015385101 6:132613369-132613391 ATGAGGAAAAGCAGGGAGGAAGG - Intergenic
1015710585 6:136134857-136134879 GTGCAGACAGTCAGCTAGGAAGG + Intronic
1016076025 6:139796590-139796612 GGGAAGAATATCAGAGAGGAGGG - Intergenic
1016348977 6:143146946-143146968 ACGCAGAAAATCAGGTGGGAAGG + Intronic
1016809580 6:148247006-148247028 CTGCTGAAAATAAGGGAAGAAGG + Intergenic
1017688207 6:156934823-156934845 GTTCATAAAAACAGGGAGGGAGG - Intronic
1018101838 6:160447058-160447080 GTGGAGAAAATAGGGGAGGGTGG + Intronic
1018352570 6:162976012-162976034 GAGCAGAAATTCATGGAGGTGGG + Intronic
1018570058 6:165200234-165200256 TTACAAAAAATCAAGGAGGAGGG + Intergenic
1019053424 6:169201981-169202003 GTGCACAAAAGCAGAGTGGAGGG + Intergenic
1019196627 6:170286973-170286995 GTGAAGAGAGGCAGGGAGGAAGG + Intronic
1019915672 7:4130636-4130658 GTCCAGAAACTCAGGGAGCTGGG - Intronic
1020988299 7:15163859-15163881 TTTCAGAAAATCAAAGAGGAGGG - Intergenic
1021031360 7:15740575-15740597 CTGCAGAAAATCAGAGATAAAGG + Intergenic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021986374 7:26101817-26101839 GGGCAGAAAGTGAGGGAGGATGG + Intergenic
1022103911 7:27185040-27185062 GGGCAGAAAAGAAGGGAGGCTGG + Exonic
1022114184 7:27248281-27248303 GTGGAGGACAGCAGGGAGGAAGG + Intergenic
1022313116 7:29216234-29216256 CTGCAGTATATCTGGGAGGAAGG + Intronic
1023345157 7:39264285-39264307 GTGAAGGAAACCAGGGAGCAAGG + Intronic
1023416224 7:39935508-39935530 TTGCAGAGGTTCAGGGAGGAAGG - Intergenic
1023584403 7:41714301-41714323 GGGCAGAAAAAGAGGGAGGGAGG + Intergenic
1024651969 7:51411062-51411084 TTCCAGAAAATCAAGGAGGAGGG + Intergenic
1024842857 7:53607047-53607069 TTGCAAAAAATCAAGAAGGAGGG + Intergenic
1025037143 7:55601672-55601694 TTCCAGAAAATCGAGGAGGAGGG + Intergenic
1025800433 7:64781785-64781807 CTGAAGAAAATAATGGAGGATGG + Intergenic
1026597051 7:71742046-71742068 GTGCGGAAAAGAAGGAAGGAAGG - Intergenic
1028051537 7:86193946-86193968 GTGAAGAGAAGGAGGGAGGAAGG + Intergenic
1028304895 7:89250547-89250569 TTCCAGAAAATCAAGGAGGAGGG + Intronic
1028593139 7:92519911-92519933 GTCCACAAAAGCAGAGAGGAAGG - Intronic
1029051830 7:97697665-97697687 TTGAAGAAAGTCAGGGAGGCAGG - Intergenic
1029369295 7:100137880-100137902 TTGCAAAAACTGAGGGAGGAAGG + Intergenic
1029531363 7:101127399-101127421 CTGCAGGAGAGCAGGGAGGATGG + Intronic
1030605340 7:111633649-111633671 GTGCAGCACACCAGGGAGGAGGG - Intergenic
1031465717 7:122108279-122108301 TTCCAGAATATCAAGGAGGAGGG + Intronic
1032539680 7:132692813-132692835 AGGCAGAGGATCAGGGAGGATGG - Intronic
1033686068 7:143642612-143642634 GAGCAGAAATTCTGGGAGAAGGG - Intronic
1033689670 7:143724703-143724725 GAGCAGAAATTCTGGGAGAAGGG + Exonic
1033698545 7:143815009-143815031 GAGCAGAAATTCTGGGAGAAGGG + Intergenic
1034359717 7:150483704-150483726 GTGATCAAAATCAGGAAGGAAGG - Intergenic
1034379327 7:150676477-150676499 GTGATCAAAATCAGGAAGGAAGG - Intergenic
1034563204 7:151894724-151894746 GGGCAGAGGAGCAGGGAGGATGG - Intergenic
1034837253 7:154363980-154364002 GAGCAGAAAGTCAGGGCGGTGGG + Intronic
1035001188 7:155613329-155613351 GTGTAAAAAATAAGGTAGGATGG + Intronic
1035293782 7:157856095-157856117 GTGCCGAGAATCAGGCAGGGAGG - Intronic
1035415826 7:158684912-158684934 GTGCAGAGGAGCAGAGAGGATGG + Intronic
1035645887 8:1219650-1219672 TTCCAAAAAATCAAGGAGGAGGG - Intergenic
1035976520 8:4318338-4318360 GTGCATAAAAAGAGAGAGGAGGG - Intronic
1036198871 8:6749247-6749269 CTGCAGAAAGTTAGGGAGGGAGG + Intronic
1036978188 8:13438807-13438829 GTGCAGTGAATCAGAGTGGATGG - Intronic
1037107294 8:15124831-15124853 CTTTAAAAAATCAGGGAGGAAGG + Intronic
1037147131 8:15585990-15586012 CTGAAGAAAATCAGTGAAGAAGG + Intronic
1037219986 8:16507170-16507192 GTGCAGAAACTGAGGGGTGATGG + Intronic
1038188159 8:25294335-25294357 ATGCTGTAAAACAGGGAGGAGGG + Intronic
1038755985 8:30340943-30340965 GTGCAGCAAATTGGAGAGGAGGG + Intergenic
1039717685 8:40127909-40127931 GTCCAGAAGATCATGCAGGATGG - Intergenic
1039971079 8:42322220-42322242 GTCCAGCGAATCAGAGAGGAGGG - Intronic
1040581954 8:48705533-48705555 GTGGAGAAAAACAGCCAGGAGGG + Intergenic
1040711593 8:50195431-50195453 GGCCAGAAATCCAGGGAGGATGG - Intronic
1041220358 8:55644950-55644972 TTCCAAAAAATCAAGGAGGAAGG - Intergenic
1041390234 8:57341260-57341282 GGACAGAAAATCTGGAAGGAGGG + Intergenic
1042405599 8:68401948-68401970 GTTCCAAAAATCAAGGAGGAGGG - Intronic
1042719196 8:71808728-71808750 GTACCCAAAATCAGGGAGGGCGG + Intergenic
1043095771 8:75970191-75970213 ATGCAGAAACTCAGGGAGGAGGG - Intergenic
1043363505 8:79503456-79503478 CTACAGAAGATCAGGGAAGAGGG - Intergenic
1043519672 8:81030852-81030874 GTGCAGTAAGAAAGGGAGGAGGG + Intronic
1043862033 8:85329777-85329799 GTCCAGAAATCCAGGGATGAAGG + Exonic
1043930569 8:86086114-86086136 GAGCAGAAAGAGAGGGAGGAGGG + Intronic
1044933913 8:97275999-97276021 CTGCAGAACATCAAGCAGGATGG + Exonic
1046098984 8:109593103-109593125 GTTCAGAAGATCTGGGAGGAGGG + Intronic
1046657572 8:116912325-116912347 GTGAAGTAAAGAAGGGAGGAGGG + Intergenic
1047405991 8:124586321-124586343 GTGCAGATAGGCAGGGAAGATGG - Intronic
1048195769 8:132330688-132330710 CTGCAGAAAATCAGGGACTAGGG - Intronic
1049126439 8:140793442-140793464 GTGCCTAGAATCAGGGAGGAAGG + Intronic
1049427452 8:142543766-142543788 GTGCACAAATCCAGGGAAGAAGG - Intronic
1050177859 9:2887454-2887476 TTCCAAAAAATCAAGGAGGAGGG + Intergenic
1051604887 9:18909186-18909208 TTGCAGAAAATGAGGAAGGGAGG + Exonic
1051720695 9:20034156-20034178 GTGTAGATAATCAAGCAGGAAGG - Intergenic
1052582364 9:30374249-30374271 TTGCAGAAAATAAAAGAGGAGGG + Intergenic
1053534541 9:38912863-38912885 GAGCAGAGAAGCTGGGAGGAAGG - Intergenic
1053636162 9:40007096-40007118 CTCCAAAAAATCAAGGAGGAGGG + Intergenic
1053769827 9:41457556-41457578 CTCCAAAAAATCAAGGAGGAGGG - Intergenic
1054206760 9:62137283-62137305 GAGCAGAGAAGCTGGGAGGAAGG - Intergenic
1054456895 9:65436331-65436353 GGGCAGAGGATCAGAGAGGAGGG + Intergenic
1054548500 9:66369031-66369053 CTCCAAAAAATCAAGGAGGAGGG - Intergenic
1054631592 9:67451064-67451086 GAGCAGAGAAGCTGGGAGGAAGG + Intergenic
1054828203 9:69594502-69594524 GTGAAGAGAATCAGGGAGTGAGG + Intronic
1055926294 9:81513674-81513696 GTGTATAAAATAAGGAAGGAAGG + Intergenic
1056071303 9:82989791-82989813 TAGCAGAAAACCAGGTAGGAGGG + Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1058246233 9:102628993-102629015 TTCCAAAAAATCAAGGAGGAGGG - Intergenic
1058710330 9:107673439-107673461 CGGCAGGAAATCAGGGATGAAGG + Intergenic
1060146903 9:121260841-121260863 GTGCAAAAGAACAGGGAGAAGGG + Intronic
1060395936 9:123316583-123316605 GTGCAGAGAAAGAGGAAGGAAGG + Intergenic
1061423615 9:130485536-130485558 GGACAGAAAAGCAGGGAGGCGGG + Intronic
1062011998 9:134272377-134272399 GTGCAGAACATAAGGGGGGAAGG + Intergenic
1062172653 9:135144094-135144116 GGGCAGAAAAGGAGGGAGCAGGG - Intergenic
1185593022 X:1291247-1291269 AGGCAGAAAGGCAGGGAGGAAGG - Intronic
1185839587 X:3376251-3376273 GTTCAGATAACCAGGGAGCAGGG - Intergenic
1186145651 X:6621680-6621702 GTGAAGAAAAGAAGGAAGGAGGG + Intergenic
1186461579 X:9752598-9752620 CTGCAGAGAACCAGAGAGGAGGG + Intronic
1187804218 X:23100570-23100592 GTGAAGAAAATGAGGGTGGTGGG - Intergenic
1188119774 X:26290017-26290039 TTCCAGAAAATCAAGGAGGAAGG - Intergenic
1188288613 X:28360903-28360925 GTGCAGAAAATCATTCAAGATGG + Intergenic
1188371397 X:29374170-29374192 TTTCAAAAAATCAAGGAGGAAGG - Intronic
1188695665 X:33187634-33187656 GGGCAAAAAATGAGGTAGGAAGG + Intronic
1189652419 X:43204164-43204186 ATGAAGAAAAGCAGGGAGCAGGG - Intergenic
1189894248 X:45637326-45637348 TTCCAAAAAAGCAGGGAGGAGGG + Intergenic
1191893460 X:65968468-65968490 ATGCAGAAGATCATGGAGAAGGG + Intergenic
1193083513 X:77427987-77428009 GTGGAGAACATCTGGGAAGATGG - Intergenic
1193300259 X:79881060-79881082 GTGAAGAAACTGAGGGTGGATGG + Intergenic
1194395659 X:93382094-93382116 TTCCAAAAAATCAAGGAGGAAGG + Intergenic
1196035176 X:111136154-111136176 ATGCTGAAAGTAAGGGAGGAGGG + Intronic
1196608091 X:117678639-117678661 TTCCAAAAAATCAAGGAGGAGGG + Intergenic
1199028292 X:142965552-142965574 GTGCAGAAAATGAATTAGGAGGG - Intergenic
1200138039 X:153884398-153884420 GTGTAGCAAACCAGGGAGGCTGG + Intronic
1201460950 Y:14223843-14223865 CTGCATAAAATCAGGCAGCAAGG + Intergenic