ID: 944659559

View in Genome Browser
Species Human (GRCh38)
Location 2:201910077-201910099
Sequence CAGCCCAAAGACACTGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944659556_944659559 7 Left 944659556 2:201910047-201910069 CCAACACTTGATGAGTCAGGGTA No data
Right 944659559 2:201910077-201910099 CAGCCCAAAGACACTGTAGCTGG No data
944659552_944659559 26 Left 944659552 2:201910028-201910050 CCACAACCTTTTTCAGTCGCCAA No data
Right 944659559 2:201910077-201910099 CAGCCCAAAGACACTGTAGCTGG No data
944659553_944659559 20 Left 944659553 2:201910034-201910056 CCTTTTTCAGTCGCCAACACTTG No data
Right 944659559 2:201910077-201910099 CAGCCCAAAGACACTGTAGCTGG No data
944659551_944659559 30 Left 944659551 2:201910024-201910046 CCTTCCACAACCTTTTTCAGTCG No data
Right 944659559 2:201910077-201910099 CAGCCCAAAGACACTGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944659559 Original CRISPR CAGCCCAAAGACACTGTAGC TGG Intergenic
No off target data available for this crispr