ID: 944660717

View in Genome Browser
Species Human (GRCh38)
Location 2:201919373-201919395
Sequence GAGAACAGTCTGAACACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944660717_944660719 -8 Left 944660717 2:201919373-201919395 CCTTCTGTGTTCAGACTGTTCTC No data
Right 944660719 2:201919388-201919410 CTGTTCTCATCAGTGCCTATGGG No data
944660717_944660718 -9 Left 944660717 2:201919373-201919395 CCTTCTGTGTTCAGACTGTTCTC No data
Right 944660718 2:201919387-201919409 ACTGTTCTCATCAGTGCCTATGG No data
944660717_944660721 7 Left 944660717 2:201919373-201919395 CCTTCTGTGTTCAGACTGTTCTC No data
Right 944660721 2:201919403-201919425 CCTATGGGACTTAGTCCATCAGG No data
944660717_944660722 8 Left 944660717 2:201919373-201919395 CCTTCTGTGTTCAGACTGTTCTC No data
Right 944660722 2:201919404-201919426 CTATGGGACTTAGTCCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944660717 Original CRISPR GAGAACAGTCTGAACACAGA AGG (reversed) Intergenic
No off target data available for this crispr