ID: 944663082

View in Genome Browser
Species Human (GRCh38)
Location 2:201937440-201937462
Sequence ACATGAGGCTCTCTTTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944663072_944663082 19 Left 944663072 2:201937398-201937420 CCTCTGCATTTCCCAGCTTCCTT No data
Right 944663082 2:201937440-201937462 ACATGAGGCTCTCTTTCTTTGGG No data
944663076_944663082 -5 Left 944663076 2:201937422-201937444 CCTCATCAGCCTTTGCCCACATG No data
Right 944663082 2:201937440-201937462 ACATGAGGCTCTCTTTCTTTGGG No data
944663074_944663082 7 Left 944663074 2:201937410-201937432 CCAGCTTCCTTTCCTCATCAGCC No data
Right 944663082 2:201937440-201937462 ACATGAGGCTCTCTTTCTTTGGG No data
944663073_944663082 8 Left 944663073 2:201937409-201937431 CCCAGCTTCCTTTCCTCATCAGC No data
Right 944663082 2:201937440-201937462 ACATGAGGCTCTCTTTCTTTGGG No data
944663075_944663082 0 Left 944663075 2:201937417-201937439 CCTTTCCTCATCAGCCTTTGCCC No data
Right 944663082 2:201937440-201937462 ACATGAGGCTCTCTTTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944663082 Original CRISPR ACATGAGGCTCTCTTTCTTT GGG Intergenic
No off target data available for this crispr