ID: 944663108

View in Genome Browser
Species Human (GRCh38)
Location 2:201937599-201937621
Sequence CGCTCCCTCCCTAACACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944663103_944663108 20 Left 944663103 2:201937556-201937578 CCAGGAGGAGAGTGATGCACTGA No data
Right 944663108 2:201937599-201937621 CGCTCCCTCCCTAACACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944663108 Original CRISPR CGCTCCCTCCCTAACACTGG GGG Intergenic
No off target data available for this crispr