ID: 944665040

View in Genome Browser
Species Human (GRCh38)
Location 2:201952622-201952644
Sequence CACACTGCACAAAATAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944665033_944665040 16 Left 944665033 2:201952583-201952605 CCATGAGACAGCCCCCGTTAGGT No data
Right 944665040 2:201952622-201952644 CACACTGCACAAAATAAGGTTGG No data
944665034_944665040 5 Left 944665034 2:201952594-201952616 CCCCCGTTAGGTCAACCTCACGC No data
Right 944665040 2:201952622-201952644 CACACTGCACAAAATAAGGTTGG No data
944665035_944665040 4 Left 944665035 2:201952595-201952617 CCCCGTTAGGTCAACCTCACGCA No data
Right 944665040 2:201952622-201952644 CACACTGCACAAAATAAGGTTGG No data
944665036_944665040 3 Left 944665036 2:201952596-201952618 CCCGTTAGGTCAACCTCACGCAG No data
Right 944665040 2:201952622-201952644 CACACTGCACAAAATAAGGTTGG No data
944665038_944665040 -10 Left 944665038 2:201952609-201952631 CCTCACGCAGCAGCACACTGCAC No data
Right 944665040 2:201952622-201952644 CACACTGCACAAAATAAGGTTGG No data
944665031_944665040 17 Left 944665031 2:201952582-201952604 CCCATGAGACAGCCCCCGTTAGG No data
Right 944665040 2:201952622-201952644 CACACTGCACAAAATAAGGTTGG No data
944665037_944665040 2 Left 944665037 2:201952597-201952619 CCGTTAGGTCAACCTCACGCAGC No data
Right 944665040 2:201952622-201952644 CACACTGCACAAAATAAGGTTGG No data
944665030_944665040 18 Left 944665030 2:201952581-201952603 CCCCATGAGACAGCCCCCGTTAG No data
Right 944665040 2:201952622-201952644 CACACTGCACAAAATAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944665040 Original CRISPR CACACTGCACAAAATAAGGT TGG Intergenic
No off target data available for this crispr