ID: 944667109

View in Genome Browser
Species Human (GRCh38)
Location 2:201967676-201967698
Sequence TCTTGGGTTTTCATTAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944667109_944667120 19 Left 944667109 2:201967676-201967698 CCAGTCTTAATGAAAACCCAAGA No data
Right 944667120 2:201967718-201967740 AAAGGGGCTAACTGCGGAGGCGG No data
944667109_944667116 2 Left 944667109 2:201967676-201967698 CCAGTCTTAATGAAAACCCAAGA No data
Right 944667116 2:201967701-201967723 AGCTTTGGGAAAATGTGAAAGGG No data
944667109_944667119 16 Left 944667109 2:201967676-201967698 CCAGTCTTAATGAAAACCCAAGA No data
Right 944667119 2:201967715-201967737 GTGAAAGGGGCTAACTGCGGAGG No data
944667109_944667115 1 Left 944667109 2:201967676-201967698 CCAGTCTTAATGAAAACCCAAGA No data
Right 944667115 2:201967700-201967722 GAGCTTTGGGAAAATGTGAAAGG No data
944667109_944667118 13 Left 944667109 2:201967676-201967698 CCAGTCTTAATGAAAACCCAAGA No data
Right 944667118 2:201967712-201967734 AATGTGAAAGGGGCTAACTGCGG No data
944667109_944667122 21 Left 944667109 2:201967676-201967698 CCAGTCTTAATGAAAACCCAAGA No data
Right 944667122 2:201967720-201967742 AGGGGCTAACTGCGGAGGCGGGG No data
944667109_944667123 22 Left 944667109 2:201967676-201967698 CCAGTCTTAATGAAAACCCAAGA No data
Right 944667123 2:201967721-201967743 GGGGCTAACTGCGGAGGCGGGGG No data
944667109_944667117 3 Left 944667109 2:201967676-201967698 CCAGTCTTAATGAAAACCCAAGA No data
Right 944667117 2:201967702-201967724 GCTTTGGGAAAATGTGAAAGGGG No data
944667109_944667121 20 Left 944667109 2:201967676-201967698 CCAGTCTTAATGAAAACCCAAGA No data
Right 944667121 2:201967719-201967741 AAGGGGCTAACTGCGGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944667109 Original CRISPR TCTTGGGTTTTCATTAAGAC TGG (reversed) Intergenic
No off target data available for this crispr