ID: 944667113

View in Genome Browser
Species Human (GRCh38)
Location 2:201967692-201967714
Sequence ATTTTCCCAAAGCTCCTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944667113_944667124 18 Left 944667113 2:201967692-201967714 CCCAAGAGGAGCTTTGGGAAAAT No data
Right 944667124 2:201967733-201967755 GGAGGCGGGGGAGCCACCCACGG No data
944667113_944667122 5 Left 944667113 2:201967692-201967714 CCCAAGAGGAGCTTTGGGAAAAT No data
Right 944667122 2:201967720-201967742 AGGGGCTAACTGCGGAGGCGGGG No data
944667113_944667120 3 Left 944667113 2:201967692-201967714 CCCAAGAGGAGCTTTGGGAAAAT No data
Right 944667120 2:201967718-201967740 AAAGGGGCTAACTGCGGAGGCGG No data
944667113_944667123 6 Left 944667113 2:201967692-201967714 CCCAAGAGGAGCTTTGGGAAAAT No data
Right 944667123 2:201967721-201967743 GGGGCTAACTGCGGAGGCGGGGG No data
944667113_944667118 -3 Left 944667113 2:201967692-201967714 CCCAAGAGGAGCTTTGGGAAAAT No data
Right 944667118 2:201967712-201967734 AATGTGAAAGGGGCTAACTGCGG No data
944667113_944667121 4 Left 944667113 2:201967692-201967714 CCCAAGAGGAGCTTTGGGAAAAT No data
Right 944667121 2:201967719-201967741 AAGGGGCTAACTGCGGAGGCGGG No data
944667113_944667119 0 Left 944667113 2:201967692-201967714 CCCAAGAGGAGCTTTGGGAAAAT No data
Right 944667119 2:201967715-201967737 GTGAAAGGGGCTAACTGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944667113 Original CRISPR ATTTTCCCAAAGCTCCTCTT GGG (reversed) Intergenic
No off target data available for this crispr