ID: 944667120

View in Genome Browser
Species Human (GRCh38)
Location 2:201967718-201967740
Sequence AAAGGGGCTAACTGCGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944667114_944667120 2 Left 944667114 2:201967693-201967715 CCAAGAGGAGCTTTGGGAAAATG No data
Right 944667120 2:201967718-201967740 AAAGGGGCTAACTGCGGAGGCGG No data
944667109_944667120 19 Left 944667109 2:201967676-201967698 CCAGTCTTAATGAAAACCCAAGA No data
Right 944667120 2:201967718-201967740 AAAGGGGCTAACTGCGGAGGCGG No data
944667113_944667120 3 Left 944667113 2:201967692-201967714 CCCAAGAGGAGCTTTGGGAAAAT No data
Right 944667120 2:201967718-201967740 AAAGGGGCTAACTGCGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944667120 Original CRISPR AAAGGGGCTAACTGCGGAGG CGG Intergenic
No off target data available for this crispr