ID: 944668087

View in Genome Browser
Species Human (GRCh38)
Location 2:201973124-201973146
Sequence CTGGCTGCCCTGAATGCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944668087_944668097 25 Left 944668087 2:201973124-201973146 CCGTCAGCATTCAGGGCAGCCAG No data
Right 944668097 2:201973172-201973194 CTGGCCTGGGAGACCCATCAAGG No data
944668087_944668093 11 Left 944668087 2:201973124-201973146 CCGTCAGCATTCAGGGCAGCCAG No data
Right 944668093 2:201973158-201973180 TTCCAGGAGGCTGCCTGGCCTGG No data
944668087_944668091 -2 Left 944668087 2:201973124-201973146 CCGTCAGCATTCAGGGCAGCCAG No data
Right 944668091 2:201973145-201973167 AGGCGTCTGCAAATTCCAGGAGG No data
944668087_944668092 6 Left 944668087 2:201973124-201973146 CCGTCAGCATTCAGGGCAGCCAG No data
Right 944668092 2:201973153-201973175 GCAAATTCCAGGAGGCTGCCTGG No data
944668087_944668094 12 Left 944668087 2:201973124-201973146 CCGTCAGCATTCAGGGCAGCCAG No data
Right 944668094 2:201973159-201973181 TCCAGGAGGCTGCCTGGCCTGGG No data
944668087_944668089 -5 Left 944668087 2:201973124-201973146 CCGTCAGCATTCAGGGCAGCCAG No data
Right 944668089 2:201973142-201973164 GCCAGGCGTCTGCAAATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944668087 Original CRISPR CTGGCTGCCCTGAATGCTGA CGG (reversed) Intergenic
No off target data available for this crispr