ID: 944668892

View in Genome Browser
Species Human (GRCh38)
Location 2:201979187-201979209
Sequence CAGTCTGAGCAGGGTGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944668883_944668892 30 Left 944668883 2:201979134-201979156 CCACATTAAAGTCAGAGAGGAAA No data
Right 944668892 2:201979187-201979209 CAGTCTGAGCAGGGTGTGGCAGG No data
944668886_944668892 -4 Left 944668886 2:201979168-201979190 CCAGCTGCTCCAACTCCTTCAGT No data
Right 944668892 2:201979187-201979209 CAGTCTGAGCAGGGTGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944668892 Original CRISPR CAGTCTGAGCAGGGTGTGGC AGG Intergenic
No off target data available for this crispr