ID: 944669109

View in Genome Browser
Species Human (GRCh38)
Location 2:201980692-201980714
Sequence CACAACCACGTGTCTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944669109_944669114 19 Left 944669109 2:201980692-201980714 CCAGCAGGAGACACGTGGTTGTG No data
Right 944669114 2:201980734-201980756 ACATCCTGTACTCTCACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944669109 Original CRISPR CACAACCACGTGTCTCCTGC TGG (reversed) Intergenic
No off target data available for this crispr