ID: 944671112

View in Genome Browser
Species Human (GRCh38)
Location 2:201995408-201995430
Sequence CTGGCCCACCTGAGCTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944671112_944671126 29 Left 944671112 2:201995408-201995430 CCCCAAGAGCTCAGGTGGGCCAG No data
Right 944671126 2:201995460-201995482 CCTTGCTGTGCAGGATATCCTGG No data
944671112_944671119 -6 Left 944671112 2:201995408-201995430 CCCCAAGAGCTCAGGTGGGCCAG No data
Right 944671119 2:201995425-201995447 GGCCAGGAGGAGGGATGAGATGG No data
944671112_944671121 1 Left 944671112 2:201995408-201995430 CCCCAAGAGCTCAGGTGGGCCAG No data
Right 944671121 2:201995432-201995454 AGGAGGGATGAGATGGAGCCTGG No data
944671112_944671124 20 Left 944671112 2:201995408-201995430 CCCCAAGAGCTCAGGTGGGCCAG No data
Right 944671124 2:201995451-201995473 CTGGAGAGGCCTTGCTGTGCAGG No data
944671112_944671122 6 Left 944671112 2:201995408-201995430 CCCCAAGAGCTCAGGTGGGCCAG No data
Right 944671122 2:201995437-201995459 GGATGAGATGGAGCCTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944671112 Original CRISPR CTGGCCCACCTGAGCTCTTG GGG (reversed) Intergenic
No off target data available for this crispr