ID: 944675511

View in Genome Browser
Species Human (GRCh38)
Location 2:202032391-202032413
Sequence GCACCCGGGACTGAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944675506_944675511 4 Left 944675506 2:202032364-202032386 CCTGATCAGAAATCGCTCAGAGC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 944675511 2:202032391-202032413 GCACCCGGGACTGAGGCAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 231
944675505_944675511 15 Left 944675505 2:202032353-202032375 CCAAGGTTCAACCTGATCAGAAA 0: 1
1: 0
2: 1
3: 6
4: 113
Right 944675511 2:202032391-202032413 GCACCCGGGACTGAGGCAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944675511 Original CRISPR GCACCCGGGACTGAGGCAGA AGG Intergenic
900129743 1:1082354-1082376 GCACCCTGGTCTCAGGCAGCTGG + Exonic
900714074 1:4132948-4132970 GCAACGGGGACTGGGGCTGAGGG + Intergenic
901744668 1:11364312-11364334 ACACCAGGGAGTGAGGCAGGAGG - Intergenic
902307322 1:15551720-15551742 GCTCGGGAGACTGAGGCAGAAGG - Intronic
902793431 1:18784641-18784663 GCACAAGGGACTGAGCAAGAGGG + Intergenic
903203837 1:21765506-21765528 ACTCCAGAGACTGAGGCAGAAGG + Intronic
903776013 1:25794267-25794289 GCCCCCGGGACTTTGCCAGATGG - Intergenic
904962299 1:34343555-34343577 GCACCCAGGAATGATACAGAGGG + Intergenic
905162392 1:36047768-36047790 CTACTCGGGACTGAGGCAGGAGG + Intronic
907650594 1:56291305-56291327 GCACACTGGGCTGTGGCAGAAGG + Intergenic
910835600 1:91506114-91506136 GCTACAGAGACTGAGGCAGAAGG - Intronic
911188437 1:94926393-94926415 GCACCCGGGGCCCGGGCAGATGG + Intronic
912328722 1:108796240-108796262 GCACTTGGAACTGATGCAGAAGG + Exonic
912680386 1:111725504-111725526 GCAGCCGGGACGGAGGGGGAAGG - Exonic
913055836 1:115158845-115158867 GCACCAGGCAGTGAGGAAGATGG + Intergenic
915042978 1:152983841-152983863 GCACCTGGGTCTGAGGATGAGGG + Intergenic
916408192 1:164518428-164518450 GCTCAGGGGGCTGAGGCAGAAGG + Intergenic
917111973 1:171557810-171557832 GCAAGTGGGACTGAGGCAGTTGG - Exonic
920697142 1:208189525-208189547 GAACCTGGGGCTGAGGCAGAAGG + Intronic
921062694 1:211599053-211599075 GCCCCCGTGACTTAGGCACAAGG + Intergenic
921075156 1:211694766-211694788 CCACCCTGGGCAGAGGCAGAGGG + Intergenic
921564042 1:216694665-216694687 GTACTCGGGGCTGAGGCAGGAGG - Intronic
922619414 1:226980884-226980906 GCACCCGGCTCCGGGGCAGAGGG + Intronic
922739503 1:228007298-228007320 GCACGCGGGGCTGGAGCAGAAGG - Intronic
924177259 1:241404084-241404106 GCACCTGGGAGAGGGGCAGAAGG - Intergenic
924350800 1:243112836-243112858 GCCACTGGGACTGAGGCAGGAGG - Intergenic
1062980198 10:1715842-1715864 GCGCCAGCCACTGAGGCAGAGGG - Intronic
1066482202 10:35808038-35808060 GGAGGCTGGACTGAGGCAGATGG - Intergenic
1070890668 10:79940521-79940543 GGACCTGGGACTGTGGCAGGGGG - Intronic
1074877830 10:117627988-117628010 GCACGAGGGACTGAGTCTGAGGG - Intergenic
1075687535 10:124375053-124375075 TCCCTCGGGACTGAGGGAGATGG + Intergenic
1075961544 10:126571505-126571527 GCACCCTGGAAGGATGCAGAGGG + Intronic
1076070175 10:127482734-127482756 GCATCCGTTACTGAGTCAGAGGG - Intergenic
1077105323 11:839751-839773 CCACTCGGGGCTGAGGCAGGAGG - Exonic
1077284578 11:1759972-1759994 GCACCCGGGGCTCAGGCTGAGGG - Intronic
1077316036 11:1919783-1919805 CCACCCAGGACTGGGGCCGACGG + Intronic
1077975687 11:7246208-7246230 CCAGCAGGGACTGTGGCAGAAGG - Intronic
1078666489 11:13330021-13330043 GCACACACGACTTAGGCAGACGG + Intronic
1080997944 11:37627536-37627558 TTACCAGGGACTGAGGGAGATGG - Intergenic
1081804296 11:45881979-45882001 GCTCCAAGGACTCAGGCAGAGGG + Exonic
1085083258 11:73650450-73650472 ACACTAGGGACTGAGGCTGAGGG + Intronic
1085428997 11:76430398-76430420 GCAGCTGGGACTAAGGCACATGG + Intergenic
1086483777 11:87274715-87274737 GCTCAGGAGACTGAGGCAGAAGG + Intronic
1088686136 11:112285953-112285975 GCACCAGGGGCAGAGGCTGATGG + Intergenic
1091694478 12:2618534-2618556 GCAGCCAGGGCTGAGGCAGTGGG + Intronic
1093426998 12:19038735-19038757 GGACTCGGACCTGAGGCAGAGGG - Intergenic
1094114565 12:26896542-26896564 ACACCAGGGACTGAGGAACAAGG - Intergenic
1095269466 12:40199839-40199861 GCACTTGAGGCTGAGGCAGAAGG + Intronic
1096741817 12:53699053-53699075 GCTCCAGGGACTGAGGCAGGAGG - Intergenic
1096878265 12:54647082-54647104 CCACCCAGGACTGGGGCAGGAGG + Intronic
1096980996 12:55728343-55728365 GCTGCCGGGCCTGGGGCAGAGGG + Exonic
1097352165 12:58560519-58560541 TTGCCGGGGACTGAGGCAGAGGG - Intronic
1097980054 12:65729200-65729222 GGACCGGGGACTGAGGAAGGAGG - Intergenic
1101790047 12:107918068-107918090 GCACTGGGGACTGTGGCAGTGGG + Intergenic
1105735835 13:23269447-23269469 GGGCTGGGGACTGAGGCAGACGG - Intronic
1105874763 13:24541668-24541690 GCTCCTGGGACTCAGGCACATGG + Intergenic
1106036901 13:26051708-26051730 GCTCCCGGGACTGCGGCTGGGGG - Intergenic
1107535430 13:41324813-41324835 GCTCCAGAGACTGAGGCAGGAGG + Intronic
1107959067 13:45543020-45543042 TCCCCTGGGAATGAGGCAGATGG - Intronic
1110804998 13:79744216-79744238 GCACCCTAGACTTAGGCAGGAGG - Intergenic
1111979667 13:95003013-95003035 GCTCCCGGGCCGGCGGCAGAGGG + Intergenic
1112297625 13:98202188-98202210 TCCCCCGGGACAGAGGCACAAGG + Intronic
1115788079 14:36848474-36848496 GCAACAGGGACTGAGCAAGAGGG + Intronic
1118332042 14:64822687-64822709 TCACTCAGGACAGAGGCAGAGGG + Intronic
1119749088 14:77064896-77064918 GCACCAGGCACAGAGGCAGGAGG + Intergenic
1121941562 14:98075638-98075660 GGATCAGGGACTTAGGCAGATGG - Intergenic
1121959406 14:98245055-98245077 GCAGTTGGGTCTGAGGCAGAGGG - Intergenic
1122013885 14:98777013-98777035 GCTCCCTGGACTGAGGCTGGAGG + Intergenic
1123076634 14:105670631-105670653 GCACTCAGCACTGAGGCTGAGGG + Intergenic
1123450963 15:20358485-20358507 CCACCAGGGACTGGAGCAGATGG - Intergenic
1124522886 15:30420318-30420340 GCAGCCAGGCCTGGGGCAGAGGG + Intergenic
1124535779 15:30545899-30545921 GCAGCCAGGCCTGGGGCAGAGGG - Intergenic
1124762871 15:32461701-32461723 GCAGCCAGGCCTGGGGCAGAGGG + Intergenic
1124775755 15:32587357-32587379 GCAGCCAGGCCTGGGGCAGAGGG - Intergenic
1125151866 15:36541755-36541777 GCACAGGAGACTGAGGCAGGAGG - Intergenic
1125834540 15:42737440-42737462 GGACCCGGGAGAGAGGTAGAGGG + Intergenic
1128601495 15:68998920-68998942 GGACCAGGGACTGGGGCAGATGG - Intronic
1131218166 15:90557737-90557759 CCAGCCTGAACTGAGGCAGAGGG + Intronic
1132592879 16:733990-734012 GCAGCCAGGCCTGAGGCTGAGGG - Intronic
1132671726 16:1104719-1104741 GCTCCCGGGGCTGAGCCACAGGG - Intergenic
1135749009 16:25041503-25041525 GCATGGGGGACTGAGGCAGGAGG + Intergenic
1136043716 16:27599822-27599844 TGACACGGGACTGAGGCGGATGG - Intronic
1136069345 16:27778701-27778723 GCTCCTGGGACTGAGGGTGAGGG - Exonic
1136372718 16:29846213-29846235 GCAGCCCGGATTGAGGGAGAAGG + Exonic
1137559336 16:49492859-49492881 GCACCGGGCACTGAACCAGATGG + Intronic
1139654921 16:68381683-68381705 TCACCCTGGACTGAGGCTGACGG - Intronic
1141617104 16:85216085-85216107 GCTCCCAGGACTGAGCGAGAGGG + Intergenic
1141993130 16:87621603-87621625 ACACCCGGGACTGTCTCAGACGG + Intronic
1142191965 16:88722240-88722262 GTACCAGGGACTGATGCGGACGG - Exonic
1142247952 16:88978407-88978429 GCCCCCAGGACTGAGGCTGGAGG + Intergenic
1142390436 16:89796283-89796305 ACACCCGGGAGTGGAGCAGAAGG + Intronic
1142410897 16:89916104-89916126 ACACCACGGTCTGAGGCAGACGG + Intronic
1142902091 17:3018401-3018423 GCACCCGGGGTTGACCCAGATGG + Intronic
1143592298 17:7892899-7892921 GCACCTGAGGCTGAGGCAGGAGG - Intronic
1143619075 17:8070869-8070891 TCAGCCGGTCCTGAGGCAGATGG + Intergenic
1144957950 17:19028977-19028999 GCACCGGGTACCCAGGCAGAAGG + Intronic
1144977208 17:19145543-19145565 GCACCGGGTACCCAGGCAGAAGG - Intronic
1145910272 17:28538237-28538259 GCACCCGGGACTGGGGAAAAAGG - Exonic
1147185916 17:38713023-38713045 GCCCTCTGGACAGAGGCAGATGG - Intronic
1147196010 17:38767108-38767130 GCCCCAGGGAGTGAGGCTGAGGG + Exonic
1148578086 17:48725320-48725342 GAGCCCGGGACTGAGGGAAAAGG - Exonic
1149431233 17:56596596-56596618 CCACTGGGGACTGAGGCGGAGGG - Intergenic
1152284143 17:79402794-79402816 GGATCCGGGTCAGAGGCAGAGGG - Intronic
1152297151 17:79474742-79474764 GCAGCAGGGACTGAGTCAGGTGG - Intronic
1152327006 17:79647584-79647606 GCTCCCGGGGCTGGGGGAGATGG - Intergenic
1152337480 17:79706860-79706882 CCACCAGGGACTGGAGCAGATGG + Intergenic
1152877271 17:82794007-82794029 CCGGCCGGCACTGAGGCAGATGG - Intronic
1153618879 18:6957675-6957697 GCACCCTGTCCAGAGGCAGAGGG + Intronic
1154326201 18:13392529-13392551 GCACCTGGGACAGAGGCCGGCGG - Intronic
1160123965 18:76153783-76153805 GCACCAGGGAATGACGCACAAGG + Intergenic
1160838416 19:1135613-1135635 GCACCCTGGACAGAGGCGGAGGG - Intronic
1161488061 19:4546376-4546398 GCACCAGGTACTGCGGGAGAGGG - Exonic
1161709239 19:5838574-5838596 GCAGACAGGACTGAGGCTGAGGG + Intronic
1164795948 19:31030191-31030213 GCACCCGGTTCAGACGCAGATGG + Intergenic
1165218868 19:34298303-34298325 GCTCCGGAGACTGAGGCAGGAGG + Intronic
1165471873 19:36008772-36008794 TCACCCGGGCCTGAGGCTGCAGG + Exonic
1165932836 19:39371352-39371374 GCAACTGGGAGGGAGGCAGATGG - Intronic
1166304271 19:41928727-41928749 GATCCCGGGACTGAGGGAGTGGG + Intronic
1166506191 19:43373130-43373152 GCTCCTGGGACTGAGGGAGAAGG - Intergenic
1166662119 19:44654095-44654117 ACTCCTGGGACTGAGGGAGAAGG + Intronic
1166719021 19:44986992-44987014 GCAGAGGGGACTGAGGCAAAGGG - Intronic
1168607296 19:57770075-57770097 GCAGGCGCGACTGAGGCAGGAGG + Intronic
925158357 2:1663949-1663971 GCACCCGTAACTCAGACAGAGGG + Intronic
926421462 2:12703885-12703907 GCAGCAGGAACTGGGGCAGATGG + Intergenic
926625404 2:15085959-15085981 GCACCAGGGATGGAGGCAGGAGG + Intergenic
927852222 2:26506515-26506537 CCCCCCGGGACTCAGGCAGCAGG - Intronic
928860860 2:35855698-35855720 CAACCAGAGACTGAGGCAGATGG - Intergenic
929588680 2:43131638-43131660 TCAGCAGGGACTGAGGGAGAAGG - Intergenic
929619702 2:43342104-43342126 GCTCAGGGGACTGAGGCGGAGGG + Intronic
929776595 2:44934387-44934409 GCCCCCGGGGCTGGGGCACAGGG - Intergenic
929789479 2:45012834-45012856 GCGCCCAGGACAGAGCCAGAAGG + Intergenic
929808840 2:45170619-45170641 GCACGCGGGACAGAGGCAGGCGG - Intergenic
934557837 2:95296812-95296834 GCAGGCGGGACTGGGGCAGTGGG + Intergenic
934570609 2:95369865-95369887 GCACCAGAGGCTGAGGCAGGTGG - Intronic
934678313 2:96265546-96265568 GGACCCGGGGCTGACGGAGACGG + Intronic
934769873 2:96900820-96900842 GCACCTGGGACTCAGACATATGG + Intronic
936149661 2:110008344-110008366 GCACTCTGGACAGAGGCAGCAGG - Intergenic
936195017 2:110363025-110363047 GCACTCTGGACAGAGGCAGCAGG + Intergenic
938201359 2:129375347-129375369 GCACCAGGGCCTGAGGTAGAGGG + Intergenic
943029374 2:182668328-182668350 GAACCATGGACTTAGGCAGAGGG + Intergenic
944675511 2:202032391-202032413 GCACCCGGGACTGAGGCAGAAGG + Intergenic
945925880 2:215804141-215804163 GCTAACGGGACTGAGGCACAGGG - Intergenic
947043986 2:225957286-225957308 GCTCAGGAGACTGAGGCAGAAGG - Intergenic
947979011 2:234392892-234392914 GCTCAGGAGACTGAGGCAGAAGG + Intergenic
948155489 2:235777981-235778003 TCGCCCAGGTCTGAGGCAGAGGG - Intronic
1169212855 20:3777555-3777577 GCACGGGGTACTGAGGCGGAAGG - Exonic
1169213398 20:3779766-3779788 GCAACAAGGACTGAGGGAGAGGG + Exonic
1169259458 20:4125163-4125185 GCACAAGTGACTGAGGCAGGAGG - Intronic
1172998217 20:39086453-39086475 GAATCAGGGACAGAGGCAGATGG - Intergenic
1175105353 20:56611005-56611027 GCAACCAGGACCGAGGCAGCTGG - Intergenic
1175120395 20:56712081-56712103 ACTCTGGGGACTGAGGCAGAAGG - Intergenic
1175818843 20:61897646-61897668 CCTCCTGGGACTGGGGCAGAGGG + Intronic
1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG + Intronic
1176003776 20:62848158-62848180 ACACCGGGGCCTGATGCAGATGG + Intronic
1176034238 20:63028569-63028591 GCGGCCGGGACTCAGGAAGATGG + Intergenic
1178132619 21:29590599-29590621 CCACCCAGGGCTGAGGCAGGAGG + Intronic
1178838144 21:36115642-36115664 ACTCCCGGGGCTGAGGCAGGAGG - Intergenic
1178989429 21:37340570-37340592 GAACACGGGACAGAGGCAGGCGG + Intergenic
1179982920 21:44905804-44905826 GCAGCCGGGAGGGAGGCAGCTGG - Intronic
1180583093 22:16860021-16860043 GCACTCTGGACAGAGGCAGCAGG + Intergenic
1182428173 22:30285805-30285827 GCACCAAGGGCTGGGGCAGAGGG - Intronic
1182547639 22:31085137-31085159 GAACTCGGGACCGAGGCAGAGGG - Intronic
1183385266 22:37510492-37510514 GCACCCAGGAGTGAGGGAGCAGG - Intronic
1184103713 22:42355311-42355333 GCACCCGGGCCTGCTGGAGAAGG - Intergenic
1185394042 22:50577931-50577953 GCACCTAGGACGGGGGCAGATGG + Exonic
950510056 3:13420472-13420494 GCCCCCGGAGCTGAGGGAGAAGG + Intergenic
953561615 3:43997074-43997096 GCCCCAGAGACCGAGGCAGACGG - Intergenic
954414791 3:50387935-50387957 GCACCAGGGAGTGAGGAAGACGG + Intronic
955065476 3:55530476-55530498 GCACCAGGGACTGATCAAGATGG - Intronic
955407252 3:58633327-58633349 CCACCCGGGAGTGAGGGAGCTGG - Intergenic
960510825 3:118547230-118547252 GCTCAGGAGACTGAGGCAGAAGG - Intergenic
961423697 3:126828477-126828499 GCTCCCGGAACTGACGCAGCTGG + Intronic
961447290 3:126986819-126986841 GCACCAGGCACAGAGGCTGATGG + Intergenic
961945651 3:130684256-130684278 TCACCCAGGACTGATACAGAGGG + Exonic
964794678 3:160483893-160483915 GGCCACGGGCCTGAGGCAGAGGG + Intronic
966700118 3:182840272-182840294 GCAAAAGGGACTGAGACAGAGGG - Intronic
966746390 3:183281240-183281262 ACACCCTGGACTGAGGCTGTGGG - Intronic
968036210 3:195550194-195550216 GCTCCCGTGGCTGAGGCAGGTGG + Intergenic
968485372 4:858428-858450 GCAGCCGGCACTGGGGCAGAAGG - Intronic
969260106 4:6028067-6028089 ACACCAAGGCCTGAGGCAGAGGG + Intronic
969391267 4:6892730-6892752 GCACCCGGGACTGAGGGGCCTGG + Intergenic
969610637 4:8225899-8225921 GCTCCAGGGACTTCGGCAGAGGG - Intronic
969874048 4:10123042-10123064 GCACTGTGGACTGAGTCAGAAGG - Intergenic
970114264 4:12675877-12675899 ACTCAGGGGACTGAGGCAGAAGG + Intergenic
970213701 4:13736888-13736910 GCACAGGAGGCTGAGGCAGAAGG - Intergenic
970708616 4:18835613-18835635 GCAGCTGAGATTGAGGCAGAGGG - Intergenic
979251145 4:118567716-118567738 GCCACTGGGACTGAGGCAGGAGG + Intergenic
984666411 4:182434003-182434025 GCTCGGGAGACTGAGGCAGAAGG + Intronic
990674553 5:58168817-58168839 ACACCAGGGTCTGAGGGAGATGG - Intergenic
992747305 5:79832387-79832409 GCAGCATGGTCTGAGGCAGAAGG - Intergenic
993658085 5:90597027-90597049 GGACACAGGACAGAGGCAGAGGG + Intronic
996230538 5:121058411-121058433 GCATGTGGGACTGAGGAAGAAGG + Intergenic
996862917 5:128084730-128084752 GCACCAGGGGCTGGGGAAGAAGG - Intronic
997284390 5:132667935-132667957 GCGCCCGTGACAGAGGCAGCTGG - Intergenic
997863511 5:137441289-137441311 TCACCAGGGTATGAGGCAGAGGG + Intronic
998228551 5:140345046-140345068 GCTCCTGGGAATGAGGGAGAAGG + Intronic
1000672533 5:164080254-164080276 GCTCCGAGGGCTGAGGCAGAAGG - Intergenic
1002507339 5:179688838-179688860 GCTCCAGGGGCTGAGGCAAAAGG + Intronic
1005060864 6:21775982-21776004 GGACCCGGGACCGAGGCCTATGG - Intergenic
1005160578 6:22857435-22857457 GCTACATGGACTGAGGCAGAGGG - Intergenic
1007757635 6:44110592-44110614 GAACCCTGGCCTGAGGCAAAGGG - Intergenic
1010085196 6:71909096-71909118 GCTCCAGAGGCTGAGGCAGAAGG - Intronic
1010976687 6:82323604-82323626 GCACCCAGGGGAGAGGCAGAGGG - Intergenic
1015273006 6:131356666-131356688 GCACAGGAGGCTGAGGCAGAAGG - Intergenic
1015898941 6:138044919-138044941 GCTCGGGAGACTGAGGCAGAGGG + Intergenic
1017163827 6:151390421-151390443 GCACGCGGGACTGAGGGAAGCGG - Intronic
1019917808 7:4144677-4144699 TCACCCGGAACAGAGGCTGAGGG + Intronic
1020626606 7:10589152-10589174 TGTCCCGGGACTGAGGCTGAGGG + Intergenic
1022538603 7:31114538-31114560 GCATCCAGGACAGTGGCAGAGGG - Intergenic
1023767156 7:43522425-43522447 GCCTCCTGGACTGAGTCAGAGGG + Intronic
1025027300 7:55527058-55527080 GGACCAGGGACAGAAGCAGAGGG + Intronic
1025078569 7:55963949-55963971 ACACTGGAGACTGAGGCAGAAGG - Intronic
1026807200 7:73435902-73435924 GCACCGGGGACTGAGGATCAGGG + Exonic
1029495218 7:100892815-100892837 GCACCTGGGGGTGAGGGAGAGGG + Exonic
1029633399 7:101767710-101767732 CCACCCGGGAGTGAGGCACTTGG - Intergenic
1030239881 7:107310783-107310805 ACACCCAGGACTGAGACAGCTGG + Intronic
1031927282 7:127651014-127651036 ACACCGGAGACTGAGGCAGGAGG + Intergenic
1032069380 7:128794472-128794494 GCACCGGGGACTGAGCCTCACGG + Exonic
1033299688 7:140175965-140175987 GTCGCCGGGACTGGGGCAGATGG - Intronic
1033314741 7:140287964-140287986 GCTCCCAGTCCTGAGGCAGATGG + Intergenic
1034342016 7:150363555-150363577 GCACCTGGCACAGTGGCAGATGG + Intergenic
1034426370 7:151016289-151016311 GCACCTGGGCTAGAGGCAGAGGG + Intronic
1034859483 7:154583379-154583401 GAACCAAGGACTGAGGAAGAGGG - Intronic
1035132905 7:156672392-156672414 GCCACAGTGACTGAGGCAGAAGG + Intronic
1035410979 7:158641468-158641490 CCAATTGGGACTGAGGCAGAAGG + Exonic
1035562495 8:616657-616679 GCGCGGGGGACAGAGGCAGAGGG + Intronic
1037308503 8:17530297-17530319 GGAGCCGGGACAGAGGGAGAGGG + Intronic
1038491798 8:27976954-27976976 GCAGCCTGGACTAAGGCAGGGGG - Intronic
1041823237 8:62063257-62063279 ACACCCTGGCCTGGGGCAGAAGG + Intergenic
1042129914 8:65578343-65578365 GCACCAGGGGCTGAGGCACAAGG - Intergenic
1046531130 8:115446480-115446502 TGACCTGGGCCTGAGGCAGAAGG + Intronic
1048213907 8:132479369-132479391 GCAGCAGCGACTGAGGCTGAGGG + Intronic
1048222260 8:132552751-132552773 GCAGCCAGGACTGAGGCGGGAGG + Intergenic
1049084166 8:140464815-140464837 GCACCCGGGACGCAAGCCGAGGG - Intergenic
1049289096 8:141792077-141792099 GCAGCCGGGGAGGAGGCAGAGGG - Intergenic
1049548309 8:143245070-143245092 GCAGCCGGGACAGAGGAAGCAGG + Intergenic
1052742169 9:32403763-32403785 GCTCACGGGACTGAGCAAGATGG - Intronic
1053186163 9:36018195-36018217 ATACTCGGGACTGAGGCAGAGGG + Intergenic
1058885392 9:109319131-109319153 GCACCCGGCGCTGCGGCAGACGG - Intronic
1059561336 9:115337823-115337845 ACTCCAGAGACTGAGGCAGAAGG - Intronic
1060359346 9:122940727-122940749 GCAGCCGGGACTGGGGACGATGG - Intergenic
1062112925 9:134791969-134791991 GCACCAGGGTCTGACCCAGAAGG + Intronic
1062538033 9:137029384-137029406 GCCCCCGGGGCTGGGGCACAGGG - Intronic
1062635966 9:137491996-137492018 GCAGCAGGCACAGAGGCAGAAGG + Intronic
1186878286 X:13838820-13838842 GCACCTAGGCCTGAGGGAGAGGG - Intronic
1188485406 X:30676178-30676200 CCACTCGGGGCTGAGGCAGGAGG - Intronic
1200065272 X:153501784-153501806 GGCCCCGTGACAGAGGCAGAAGG - Intronic
1201502970 Y:14665725-14665747 GCAACAGGGAGTTAGGCAGAAGG + Intronic