ID: 944675833

View in Genome Browser
Species Human (GRCh38)
Location 2:202033817-202033839
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944675833_944675840 17 Left 944675833 2:202033817-202033839 CCCGACGCTTCTTCTGGCGACCA No data
Right 944675840 2:202033857-202033879 TAGTCGGCGCTCACTCCCGGCGG No data
944675833_944675837 1 Left 944675833 2:202033817-202033839 CCCGACGCTTCTTCTGGCGACCA No data
Right 944675837 2:202033841-202033863 CGCGACTCCGAGGCGTTAGTCGG No data
944675833_944675842 21 Left 944675833 2:202033817-202033839 CCCGACGCTTCTTCTGGCGACCA No data
Right 944675842 2:202033861-202033883 CGGCGCTCACTCCCGGCGGGCGG No data
944675833_944675835 -9 Left 944675833 2:202033817-202033839 CCCGACGCTTCTTCTGGCGACCA No data
Right 944675835 2:202033831-202033853 TGGCGACCAGCGCGACTCCGAGG No data
944675833_944675843 24 Left 944675833 2:202033817-202033839 CCCGACGCTTCTTCTGGCGACCA No data
Right 944675843 2:202033864-202033886 CGCTCACTCCCGGCGGGCGGCGG No data
944675833_944675839 14 Left 944675833 2:202033817-202033839 CCCGACGCTTCTTCTGGCGACCA No data
Right 944675839 2:202033854-202033876 CGTTAGTCGGCGCTCACTCCCGG No data
944675833_944675845 30 Left 944675833 2:202033817-202033839 CCCGACGCTTCTTCTGGCGACCA No data
Right 944675845 2:202033870-202033892 CTCCCGGCGGGCGGCGGCGGCGG No data
944675833_944675841 18 Left 944675833 2:202033817-202033839 CCCGACGCTTCTTCTGGCGACCA No data
Right 944675841 2:202033858-202033880 AGTCGGCGCTCACTCCCGGCGGG No data
944675833_944675844 27 Left 944675833 2:202033817-202033839 CCCGACGCTTCTTCTGGCGACCA No data
Right 944675844 2:202033867-202033889 TCACTCCCGGCGGGCGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944675833 Original CRISPR TGGTCGCCAGAAGAAGCGTC GGG (reversed) Intergenic