ID: 944675834

View in Genome Browser
Species Human (GRCh38)
Location 2:202033818-202033840
Sequence CTGGTCGCCAGAAGAAGCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944675834_944675845 29 Left 944675834 2:202033818-202033840 CCGACGCTTCTTCTGGCGACCAG No data
Right 944675845 2:202033870-202033892 CTCCCGGCGGGCGGCGGCGGCGG No data
944675834_944675842 20 Left 944675834 2:202033818-202033840 CCGACGCTTCTTCTGGCGACCAG No data
Right 944675842 2:202033861-202033883 CGGCGCTCACTCCCGGCGGGCGG No data
944675834_944675843 23 Left 944675834 2:202033818-202033840 CCGACGCTTCTTCTGGCGACCAG No data
Right 944675843 2:202033864-202033886 CGCTCACTCCCGGCGGGCGGCGG No data
944675834_944675835 -10 Left 944675834 2:202033818-202033840 CCGACGCTTCTTCTGGCGACCAG No data
Right 944675835 2:202033831-202033853 TGGCGACCAGCGCGACTCCGAGG No data
944675834_944675840 16 Left 944675834 2:202033818-202033840 CCGACGCTTCTTCTGGCGACCAG No data
Right 944675840 2:202033857-202033879 TAGTCGGCGCTCACTCCCGGCGG No data
944675834_944675839 13 Left 944675834 2:202033818-202033840 CCGACGCTTCTTCTGGCGACCAG No data
Right 944675839 2:202033854-202033876 CGTTAGTCGGCGCTCACTCCCGG No data
944675834_944675844 26 Left 944675834 2:202033818-202033840 CCGACGCTTCTTCTGGCGACCAG No data
Right 944675844 2:202033867-202033889 TCACTCCCGGCGGGCGGCGGCGG No data
944675834_944675841 17 Left 944675834 2:202033818-202033840 CCGACGCTTCTTCTGGCGACCAG No data
Right 944675841 2:202033858-202033880 AGTCGGCGCTCACTCCCGGCGGG No data
944675834_944675837 0 Left 944675834 2:202033818-202033840 CCGACGCTTCTTCTGGCGACCAG No data
Right 944675837 2:202033841-202033863 CGCGACTCCGAGGCGTTAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944675834 Original CRISPR CTGGTCGCCAGAAGAAGCGT CGG (reversed) Intergenic