ID: 944675836

View in Genome Browser
Species Human (GRCh38)
Location 2:202033837-202033859
Sequence CTAACGCCTCGGAGTCGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944675836_944675853 30 Left 944675836 2:202033837-202033859 CCAGCGCGACTCCGAGGCGTTAG No data
Right 944675853 2:202033890-202033912 CGGCGGCGGCGGCGGGCGCCAGG No data
944675836_944675852 23 Left 944675836 2:202033837-202033859 CCAGCGCGACTCCGAGGCGTTAG No data
Right 944675852 2:202033883-202033905 GCGGCGGCGGCGGCGGCGGCGGG No data
944675836_944675850 19 Left 944675836 2:202033837-202033859 CCAGCGCGACTCCGAGGCGTTAG No data
Right 944675850 2:202033879-202033901 GGCGGCGGCGGCGGCGGCGGCGG No data
944675836_944675849 16 Left 944675836 2:202033837-202033859 CCAGCGCGACTCCGAGGCGTTAG No data
Right 944675849 2:202033876-202033898 GCGGGCGGCGGCGGCGGCGGCGG No data
944675836_944675851 22 Left 944675836 2:202033837-202033859 CCAGCGCGACTCCGAGGCGTTAG No data
Right 944675851 2:202033882-202033904 GGCGGCGGCGGCGGCGGCGGCGG No data
944675836_944675848 13 Left 944675836 2:202033837-202033859 CCAGCGCGACTCCGAGGCGTTAG No data
Right 944675848 2:202033873-202033895 CCGGCGGGCGGCGGCGGCGGCGG No data
944675836_944675840 -3 Left 944675836 2:202033837-202033859 CCAGCGCGACTCCGAGGCGTTAG No data
Right 944675840 2:202033857-202033879 TAGTCGGCGCTCACTCCCGGCGG No data
944675836_944675844 7 Left 944675836 2:202033837-202033859 CCAGCGCGACTCCGAGGCGTTAG No data
Right 944675844 2:202033867-202033889 TCACTCCCGGCGGGCGGCGGCGG No data
944675836_944675845 10 Left 944675836 2:202033837-202033859 CCAGCGCGACTCCGAGGCGTTAG No data
Right 944675845 2:202033870-202033892 CTCCCGGCGGGCGGCGGCGGCGG No data
944675836_944675839 -6 Left 944675836 2:202033837-202033859 CCAGCGCGACTCCGAGGCGTTAG No data
Right 944675839 2:202033854-202033876 CGTTAGTCGGCGCTCACTCCCGG No data
944675836_944675842 1 Left 944675836 2:202033837-202033859 CCAGCGCGACTCCGAGGCGTTAG No data
Right 944675842 2:202033861-202033883 CGGCGCTCACTCCCGGCGGGCGG No data
944675836_944675841 -2 Left 944675836 2:202033837-202033859 CCAGCGCGACTCCGAGGCGTTAG No data
Right 944675841 2:202033858-202033880 AGTCGGCGCTCACTCCCGGCGGG No data
944675836_944675843 4 Left 944675836 2:202033837-202033859 CCAGCGCGACTCCGAGGCGTTAG No data
Right 944675843 2:202033864-202033886 CGCTCACTCCCGGCGGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944675836 Original CRISPR CTAACGCCTCGGAGTCGCGC TGG (reversed) Intergenic