ID: 944675838

View in Genome Browser
Species Human (GRCh38)
Location 2:202033848-202033870
Sequence GTGAGCGCCGACTAACGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944675838_944675848 2 Left 944675838 2:202033848-202033870 CCGAGGCGTTAGTCGGCGCTCAC No data
Right 944675848 2:202033873-202033895 CCGGCGGGCGGCGGCGGCGGCGG No data
944675838_944675844 -4 Left 944675838 2:202033848-202033870 CCGAGGCGTTAGTCGGCGCTCAC No data
Right 944675844 2:202033867-202033889 TCACTCCCGGCGGGCGGCGGCGG No data
944675838_944675853 19 Left 944675838 2:202033848-202033870 CCGAGGCGTTAGTCGGCGCTCAC No data
Right 944675853 2:202033890-202033912 CGGCGGCGGCGGCGGGCGCCAGG No data
944675838_944675852 12 Left 944675838 2:202033848-202033870 CCGAGGCGTTAGTCGGCGCTCAC No data
Right 944675852 2:202033883-202033905 GCGGCGGCGGCGGCGGCGGCGGG No data
944675838_944675842 -10 Left 944675838 2:202033848-202033870 CCGAGGCGTTAGTCGGCGCTCAC No data
Right 944675842 2:202033861-202033883 CGGCGCTCACTCCCGGCGGGCGG No data
944675838_944675849 5 Left 944675838 2:202033848-202033870 CCGAGGCGTTAGTCGGCGCTCAC No data
Right 944675849 2:202033876-202033898 GCGGGCGGCGGCGGCGGCGGCGG No data
944675838_944675850 8 Left 944675838 2:202033848-202033870 CCGAGGCGTTAGTCGGCGCTCAC No data
Right 944675850 2:202033879-202033901 GGCGGCGGCGGCGGCGGCGGCGG No data
944675838_944675851 11 Left 944675838 2:202033848-202033870 CCGAGGCGTTAGTCGGCGCTCAC No data
Right 944675851 2:202033882-202033904 GGCGGCGGCGGCGGCGGCGGCGG No data
944675838_944675843 -7 Left 944675838 2:202033848-202033870 CCGAGGCGTTAGTCGGCGCTCAC No data
Right 944675843 2:202033864-202033886 CGCTCACTCCCGGCGGGCGGCGG No data
944675838_944675845 -1 Left 944675838 2:202033848-202033870 CCGAGGCGTTAGTCGGCGCTCAC No data
Right 944675845 2:202033870-202033892 CTCCCGGCGGGCGGCGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944675838 Original CRISPR GTGAGCGCCGACTAACGCCT CGG (reversed) Intergenic