ID: 944675843

View in Genome Browser
Species Human (GRCh38)
Location 2:202033864-202033886
Sequence CGCTCACTCCCGGCGGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944675836_944675843 4 Left 944675836 2:202033837-202033859 CCAGCGCGACTCCGAGGCGTTAG No data
Right 944675843 2:202033864-202033886 CGCTCACTCCCGGCGGGCGGCGG No data
944675838_944675843 -7 Left 944675838 2:202033848-202033870 CCGAGGCGTTAGTCGGCGCTCAC No data
Right 944675843 2:202033864-202033886 CGCTCACTCCCGGCGGGCGGCGG No data
944675833_944675843 24 Left 944675833 2:202033817-202033839 CCCGACGCTTCTTCTGGCGACCA No data
Right 944675843 2:202033864-202033886 CGCTCACTCCCGGCGGGCGGCGG No data
944675834_944675843 23 Left 944675834 2:202033818-202033840 CCGACGCTTCTTCTGGCGACCAG No data
Right 944675843 2:202033864-202033886 CGCTCACTCCCGGCGGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944675843 Original CRISPR CGCTCACTCCCGGCGGGCGG CGG Intergenic