ID: 944675843

View in Genome Browser
Species Human (GRCh38)
Location 2:202033864-202033886
Sequence CGCTCACTCCCGGCGGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944675833_944675843 24 Left 944675833 2:202033817-202033839 CCCGACGCTTCTTCTGGCGACCA 0: 1
1: 0
2: 0
3: 2
4: 59
Right 944675843 2:202033864-202033886 CGCTCACTCCCGGCGGGCGGCGG 0: 1
1: 0
2: 1
3: 10
4: 149
944675838_944675843 -7 Left 944675838 2:202033848-202033870 CCGAGGCGTTAGTCGGCGCTCAC 0: 1
1: 0
2: 0
3: 0
4: 18
Right 944675843 2:202033864-202033886 CGCTCACTCCCGGCGGGCGGCGG 0: 1
1: 0
2: 1
3: 10
4: 149
944675836_944675843 4 Left 944675836 2:202033837-202033859 CCAGCGCGACTCCGAGGCGTTAG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 944675843 2:202033864-202033886 CGCTCACTCCCGGCGGGCGGCGG 0: 1
1: 0
2: 1
3: 10
4: 149
944675834_944675843 23 Left 944675834 2:202033818-202033840 CCGACGCTTCTTCTGGCGACCAG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 944675843 2:202033864-202033886 CGCTCACTCCCGGCGGGCGGCGG 0: 1
1: 0
2: 1
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944675843 Original CRISPR CGCTCACTCCCGGCGGGCGG CGG Intergenic
900119937 1:1044271-1044293 CCCTGGCTCTCGGCGGGCGGCGG + Intronic
900342266 1:2194755-2194777 CGCTCACTTCCGCCCGGCGCGGG - Exonic
903335222 1:22620054-22620076 CTCTCACTCCAGACGGGCGGAGG - Intergenic
904181400 1:28668996-28669018 CGCTCGCTCCCCGGCGGCGGCGG - Intronic
905212756 1:36385784-36385806 CTCTCCCTCCCGGGGGGCCGGGG + Exonic
906140610 1:43531565-43531587 CGCCCCCTCCCAGCCGGCGGGGG + Intronic
911664808 1:100540008-100540030 CGCTCAGTCCTGCCGGGCGTCGG + Exonic
915463992 1:156085300-156085322 CGCTCTCTCCCGGAGGCTGGTGG + Intronic
915530809 1:156501029-156501051 CCCTCCCTCCCGGCAGGCGGAGG - Intergenic
915720250 1:157979214-157979236 CGCTCCCTGCCGGCGGACTGAGG - Intergenic
916022070 1:160801837-160801859 CGCACACTCCTGGAGGGCAGCGG + Intronic
917451480 1:175151096-175151118 CGCTCACTACCTGTCGGCGGCGG + Intergenic
1064758485 10:18594114-18594136 CGCTCAAACCCGGGAGGCGGAGG + Intronic
1065925848 10:30433667-30433689 GGCACGCTCCCGGGGGGCGGCGG - Intergenic
1067977291 10:51041102-51041124 TGCTCACTCCAGGCGTGGGGTGG - Intronic
1068080706 10:52314503-52314525 CGCTCACTCCCAGCAGAGGGTGG - Exonic
1068620480 10:59176584-59176606 CGCGCGCTCCCGGCGGGGAGGGG - Exonic
1070609936 10:77926395-77926417 CGCTCAGTCCCGGCGAGCGGCGG - Exonic
1071041098 10:81309328-81309350 CGCTCATTCCCTGGGGCCGGCGG + Intergenic
1073099584 10:100999750-100999772 CGCCCACTCGCACCGGGCGGGGG + Exonic
1073844898 10:107544317-107544339 CGCTCGCACCCGGGAGGCGGAGG - Intergenic
1076166569 10:128286943-128286965 CGCTGGCCGCCGGCGGGCGGGGG - Intergenic
1076395907 10:130136955-130136977 CGCTCCCTCCCGGCGGGCACAGG - Intronic
1077229054 11:1450536-1450558 GGTTCAATCCCGGCGGGTGGGGG - Intronic
1077269340 11:1667737-1667759 CCCTCACTCCAGGTGGGTGGGGG + Intergenic
1077778211 11:5294651-5294673 CCCTCACTGCCCGCGGCCGGTGG + Intronic
1081935338 11:46899960-46899982 CTCACACTCCCGGGGGGCTGTGG + Exonic
1083560811 11:63671595-63671617 CGCGCACACGCGGCAGGCGGTGG - Exonic
1083939626 11:65888626-65888648 CGCTTCCTCCCGCCGGGAGGGGG + Intergenic
1084385790 11:68841951-68841973 GGGTGACTCCCGGCGCGCGGAGG + Intronic
1084499126 11:69524591-69524613 CTCTCCCTCCCGGCGGCTGGAGG + Intergenic
1089265656 11:117259038-117259060 TGCTCAAACCCGGCAGGCGGAGG - Intronic
1089509894 11:118989988-118990010 CGCTCAAACCCGGGAGGCGGAGG + Intergenic
1090133557 11:124170931-124170953 CCCTCACTGCCGGGGGCCGGTGG + Intergenic
1092250279 12:6891217-6891239 CGCTGACTGTCGCCGGGCGGCGG + Intronic
1097091415 12:56508316-56508338 CGCTCAAACCCGGGAGGCGGAGG - Intergenic
1097919426 12:65055689-65055711 CGCTTACACCTGGGGGGCGGAGG + Intronic
1101351070 12:103930358-103930380 CCCCCACTTCCCGCGGGCGGGGG - Exonic
1104601976 12:130161000-130161022 CGCTACCTCCCGGGGGGCCGGGG - Intergenic
1106087694 13:26557941-26557963 CGCGCGCTCCGGCCGGGCGGCGG + Intronic
1107523133 13:41203198-41203220 CGCTCAAACCCGGGAGGCGGAGG - Intergenic
1113591451 13:111504055-111504077 CGCACCCTCCCGTGGGGCGGTGG - Intergenic
1113793862 13:113045475-113045497 AGCCCAGTCCCGGCGGGTGGAGG + Intronic
1115555089 14:34539373-34539395 CGCGCAGTCCCGGGGGGAGGCGG - Intronic
1118116366 14:62781529-62781551 CGGCCACGCCCGGCGGGGGGTGG + Intronic
1118301200 14:64617959-64617981 CGCTTGATCCCGGCAGGCGGAGG + Intergenic
1121803432 14:96794582-96794604 CGCTCGAACCCGGCAGGCGGAGG - Intergenic
1126997573 15:54462562-54462584 CCCTCACTCCCCGGGGCCGGGGG - Intronic
1127997690 15:64163097-64163119 CGCGGGCTCCGGGCGGGCGGCGG + Exonic
1128839734 15:70840454-70840476 CGCTTGAACCCGGCGGGCGGAGG + Intronic
1129170296 15:73803520-73803542 CCCTCACTCCAGGAGGGCAGGGG + Intergenic
1129334279 15:74843130-74843152 CGCTTCCTCGCTGCGGGCGGCGG + Exonic
1132865904 16:2092631-2092653 CGCTCACTCGAGGCGGGCATGGG - Intronic
1133279384 16:4656462-4656484 AGATCACTCCCGGAAGGCGGAGG - Intronic
1136239831 16:28937117-28937139 CACCCACTCCCGGCGGGCTCCGG - Exonic
1143448808 17:7023679-7023701 CGCTCCCTCCGGGGCGGCGGGGG - Exonic
1144586760 17:16491995-16492017 CGGAGAGTCCCGGCGGGCGGCGG - Exonic
1147189406 17:38730164-38730186 CGCTCACGCCCGGCGTGCTGAGG + Intergenic
1147870273 17:43582276-43582298 CGCTCAAACCCAGCAGGCGGAGG - Intergenic
1148555996 17:48578797-48578819 CGCTCCCTCCCGCCGAGGGGAGG - Exonic
1149660670 17:58332610-58332632 CGCTCATCCCCTGCGGGCGGGGG - Intergenic
1150313093 17:64145726-64145748 CGCTCATTACCAGCTGGCGGTGG + Intergenic
1151563466 17:74883574-74883596 CGCACACTTCCTGAGGGCGGTGG + Intronic
1152254126 17:79227572-79227594 CGCTCATTCCCGGCTGGCTGGGG + Intronic
1152896913 17:82917101-82917123 CGCTTAATCCCGGGAGGCGGAGG - Intronic
1157464243 18:47930622-47930644 CCCTCCTTCCCCGCGGGCGGCGG - Intronic
1160994139 19:1873998-1874020 CCCTCCCTCCCTGCGGGCTGTGG - Intergenic
1161560191 19:4968939-4968961 CGCCCAATCGCGGCGCGCGGTGG + Intergenic
1166708749 19:44923894-44923916 CGCTTAAACCCGGCGGGTGGAGG + Intergenic
1167559204 19:50215245-50215267 CCCCCACTCCTGGCTGGCGGAGG - Intronic
1167897454 19:52593418-52593440 CGCTCCCTCCGGGAGGGAGGTGG - Intergenic
925928168 2:8685350-8685372 CGATCGCTCCCCGCGGGCGCTGG + Intergenic
929818844 2:45257576-45257598 CGCTCCCTCCCGCTGAGCGGAGG - Intergenic
929958798 2:46480564-46480586 CGCTCAGTCCCAGGGGTCGGGGG - Exonic
931392453 2:61855387-61855409 GGCGCACTCCCGGGAGGCGGAGG + Intergenic
941603061 2:167563789-167563811 CGCTCCCTCCGGGGGGGAGGTGG - Intergenic
942454863 2:176130592-176130614 CACCCAGTCCCGGAGGGCGGCGG - Exonic
944675843 2:202033864-202033886 CGCTCACTCCCGGCGGGCGGCGG + Intergenic
944743506 2:202634786-202634808 CGCTCCCTCCCCGCGGGGGGCGG + Intergenic
948815234 2:240507230-240507252 CTGTCATTCCTGGCGGGCGGTGG - Intronic
1170892096 20:20384783-20384805 CGCTCAAACCCGGGAGGCGGAGG - Intergenic
1171944716 20:31366389-31366411 CGCTCAAACCCGGGAGGCGGAGG + Intergenic
1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG + Exonic
1176015030 20:62926524-62926546 CGCCCCCGCGCGGCGGGCGGAGG + Intronic
1176247073 20:64102428-64102450 CCCTCCCTCCCGGCTGGCCGCGG + Intergenic
1177894555 21:26844455-26844477 CGCTCGCTGGCGGCGGGCAGCGG + Exonic
1180109826 21:45642738-45642760 CGCGAACGCCGGGCGGGCGGAGG + Intergenic
1180342479 22:11629256-11629278 CACTCACGCGCGGCGGGCGCGGG - Intergenic
1181457956 22:23070346-23070368 CGCGGACTGGCGGCGGGCGGCGG + Exonic
1181631895 22:24155978-24156000 CTCTCGCTCGCGGCGGGCCGGGG - Intronic
1183788346 22:40045038-40045060 CGCTCCGTCCCGGCGGGGCGCGG - Intronic
1184101504 22:42343736-42343758 CGCGGGCTCCCGGCGGGCGCGGG + Intergenic
1184628068 22:45753487-45753509 CGCTTAATCCCGGGAGGCGGAGG - Intronic
1185064783 22:48626303-48626325 CGCTCCTTCACGGCCGGCGGGGG - Intronic
1185197657 22:49482341-49482363 AGCTCCCTCCCGACAGGCGGGGG - Intronic
1185258369 22:49848906-49848928 CGCTTCCTCCCCGCGGGCTGCGG + Intergenic
952028805 3:29116293-29116315 CGCTCGAACCCGGGGGGCGGAGG + Intergenic
953562069 3:43999258-43999280 CCCTTACTCGCGGGGGGCGGGGG - Intergenic
954097520 3:48340770-48340792 CGCTCAATCCCAGGAGGCGGAGG + Intergenic
954303515 3:49713784-49713806 CCCACACTCCCTGCGGGCTGTGG + Exonic
954356174 3:50084820-50084842 CGCTCCCTCCGGGAGGGAGGTGG - Intronic
955321768 3:57979639-57979661 CGCTCAAACCCGGGAGGCGGAGG - Intergenic
955818759 3:62874735-62874757 CGCTCACCACCGACGGGCTGGGG + Exonic
957282530 3:78171946-78171968 CGCTCGAACCCGGCAGGCGGAGG + Intergenic
957995400 3:87682651-87682673 CGCTCAAACCCGGGAGGCGGAGG + Intergenic
966794123 3:183697938-183697960 TGCTCTCTCGCGGCGGCCGGCGG + Exonic
968059362 3:195715512-195715534 CGCTCAAACCCGGGAGGCGGAGG + Intergenic
969379568 4:6785019-6785041 CGCTTGTACCCGGCGGGCGGAGG - Intronic
972288432 4:37669339-37669361 CGCTCCCTCCGGGAGGGAGGTGG + Intronic
976846067 4:89490165-89490187 CCCTCACTGCCGGGGGCCGGCGG - Intergenic
979785534 4:124712294-124712316 CGCTCCCACCCGGCCGACGGCGG + Intronic
981262218 4:142734727-142734749 CGCTCGATCCCGGGAGGCGGAGG - Intronic
984973519 4:185210240-185210262 TACTTACCCCCGGCGGGCGGCGG - Intronic
985696738 5:1345082-1345104 CGTCCACTTCCGGCAGGCGGCGG - Exonic
989054865 5:37357021-37357043 CGCTCAATCCTGGGAGGCGGAGG + Intronic
989061570 5:37415673-37415695 ACCTCCCTCCCGCCGGGCGGAGG + Intronic
991769264 5:70025507-70025529 CGCTGAGGCGCGGCGGGCGGGGG + Intronic
991848559 5:70900925-70900947 CGCTGAGGCGCGGCGGGCGGGGG + Intronic
996552797 5:124747635-124747657 CGCCCACTGCGGGGGGGCGGGGG - Intronic
1001458790 5:171889802-171889824 CGCTCAAACCCGGGAGGCGGAGG + Intronic
1002600583 5:180352395-180352417 GGCTCTCTCCCGGCCAGCGGAGG + Intronic
1005063489 6:21797304-21797326 CGCTCCCTCCGGGCGGGAGGTGG - Intergenic
1005063537 6:21797431-21797453 CGCTCAGTCCAGGAGGGAGGTGG - Intergenic
1005825999 6:29632331-29632353 CGCCCGCGCCCGGGGGGCGGAGG + Exonic
1006209809 6:32385096-32385118 CGCTCAGTCCGGGAGGGAGGTGG - Intergenic
1013099431 6:106974701-106974723 CGCTGGCTCCGGGCGGGCGCAGG + Intronic
1016597204 6:145815334-145815356 CCCTGGATCCCGGCGGGCGGCGG + Intergenic
1019343006 7:517354-517376 CGCGCCCTCCCCGCGCGCGGAGG + Intronic
1022018585 7:26376745-26376767 CGCTCGCGCCCGGCCGGAGGAGG + Intergenic
1023663331 7:42493563-42493585 CGCCCACTCCCCGCGGCCGCTGG + Intergenic
1024965360 7:55019060-55019082 CGCTCACACCGTGCGGGGGGCGG - Intronic
1026713369 7:72764364-72764386 CGCTCAAACCCGGGAGGCGGAGG - Intronic
1032183729 7:129705372-129705394 CGCTTAATCCCGGGAGGCGGAGG - Intronic
1032298000 7:130659826-130659848 CGCTCAAACCCGGGAGGCGGAGG + Intronic
1033361250 7:140640498-140640520 CCCTACCTCCCCGCGGGCGGCGG + Exonic
1034278923 7:149838450-149838472 CGCTCTCTCACGTCGGGGGGCGG - Exonic
1036393438 8:8345709-8345731 CGCTCAAACCCGGGAGGCGGAGG + Intronic
1036910950 8:12755927-12755949 CCCCAACTCCTGGCGGGCGGGGG + Intronic
1041690288 8:60680106-60680128 CGCTGACCCCCGGCGGGTTGGGG - Intronic
1048554095 8:135457968-135457990 CGTTAACTGCCGGCCGGCGGCGG + Intronic
1049205482 8:141361637-141361659 CCCTCCCTCCAGGCTGGCGGGGG - Intronic
1049580226 8:143407651-143407673 CGCTTCCTCATGGCGGGCGGGGG + Intergenic
1059185441 9:112265417-112265439 CGCTTGAACCCGGCGGGCGGGGG + Intronic
1059375257 9:113876236-113876258 CGCTCAGGCCGGGGGGGCGGGGG - Intergenic
1060592102 9:124823883-124823905 CGCTTAAACCCGGCAGGCGGAGG - Intergenic
1061260918 9:129480674-129480696 CGCTCCCTCCAGGTGGACGGGGG + Intergenic
1062230856 9:135480504-135480526 CGTTCACTCCCGCCGGGCCGAGG + Intronic
1062472264 9:136711851-136711873 CGCTCCCTCCCCGCGGCCGCCGG - Intergenic
1062549047 9:137077673-137077695 CGAGCACTGCCGGCGGGCGGCGG + Exonic
1185684081 X:1912761-1912783 CGCTTGAACCCGGCGGGCGGAGG + Intergenic
1186245012 X:7609168-7609190 CGCTCAGTCCAGGAGGGAGGTGG - Intergenic
1186245059 X:7609295-7609317 CGCTCAGTCCAGGAGGGAGGTGG - Intergenic
1186245102 X:7609422-7609444 CGCTCAGTCCAGGAGGGAGGTGG - Intergenic
1187181379 X:16946681-16946703 CGCTTCCTCCCGGCGCGCGCCGG - Exonic
1189809023 X:44763897-44763919 CGCTTGATCCCGGCAGGCGGAGG - Intergenic
1190385456 X:49879393-49879415 CGCTCCCTCAGGCCGGGCGGGGG + Intergenic
1196613826 X:117743921-117743943 TGCTCAGTCCCGGGGGGCAGAGG - Intergenic
1197366186 X:125567260-125567282 CCATCACTCCCGGGGGTCGGGGG - Intergenic
1200253038 X:154564009-154564031 CGCTCACTCACCAGGGGCGGGGG - Exonic
1200264729 X:154640406-154640428 CGCTCACTCACCAGGGGCGGGGG + Intergenic
1201895884 Y:18992764-18992786 CGCTGGCTCCGGGCGGGCGCAGG + Intergenic