ID: 944677326

View in Genome Browser
Species Human (GRCh38)
Location 2:202044574-202044596
Sequence TGTTAGTTAGATATCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944677322_944677326 16 Left 944677322 2:202044535-202044557 CCAGTACAACTGTCTACTAATCT No data
Right 944677326 2:202044574-202044596 TGTTAGTTAGATATCATGGAGGG No data
944677321_944677326 17 Left 944677321 2:202044534-202044556 CCCAGTACAACTGTCTACTAATC No data
Right 944677326 2:202044574-202044596 TGTTAGTTAGATATCATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944677326 Original CRISPR TGTTAGTTAGATATCATGGA GGG Intergenic
No off target data available for this crispr