ID: 944678878

View in Genome Browser
Species Human (GRCh38)
Location 2:202057996-202058018
Sequence CACTACCAACTGATTGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944678877_944678878 -1 Left 944678877 2:202057974-202057996 CCAATCAAGTCTTCTAGGCAGTC No data
Right 944678878 2:202057996-202058018 CACTACCAACTGATTGAACTTGG No data
944678876_944678878 0 Left 944678876 2:202057973-202057995 CCCAATCAAGTCTTCTAGGCAGT No data
Right 944678878 2:202057996-202058018 CACTACCAACTGATTGAACTTGG No data
944678874_944678878 21 Left 944678874 2:202057952-202057974 CCAGGAGTCTGCAGAATTATGCC No data
Right 944678878 2:202057996-202058018 CACTACCAACTGATTGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944678878 Original CRISPR CACTACCAACTGATTGAACT TGG Intergenic
No off target data available for this crispr