ID: 944681053

View in Genome Browser
Species Human (GRCh38)
Location 2:202077086-202077108
Sequence TGGGGTCACCTGGAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944681053_944681064 13 Left 944681053 2:202077086-202077108 CCCAGCTCCTCCAGGTGACCCCA 0: 1
1: 0
2: 3
3: 33
4: 337
Right 944681064 2:202077122-202077144 CTGTCCTTCTAGCGTAAGTGTGG 0: 1
1: 0
2: 0
3: 7
4: 57
944681053_944681066 19 Left 944681053 2:202077086-202077108 CCCAGCTCCTCCAGGTGACCCCA 0: 1
1: 0
2: 3
3: 33
4: 337
Right 944681066 2:202077128-202077150 TTCTAGCGTAAGTGTGGTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944681053 Original CRISPR TGGGGTCACCTGGAGGAGCT GGG (reversed) Intronic
900543990 1:3218387-3218409 TGGGGATACCTGGGGAAGCTGGG - Intronic
900629053 1:3624266-3624288 TGGGGGCACCTCCGGGAGCTGGG + Intergenic
901226763 1:7617658-7617680 TAGGGTCACCTGAAGGACTTTGG + Intronic
901273904 1:7975392-7975414 CTTGGCCACCTGGAGGAGCTGGG + Intronic
901301033 1:8200314-8200336 AGGGGTCCCCGGCAGGAGCTTGG + Intergenic
902089697 1:13893289-13893311 TGGGGTCACCTGGAAGGGGCAGG - Intergenic
902782700 1:18714994-18715016 TGGGGTCCCCTGCAGGAGGAAGG + Intronic
903019967 1:20386973-20386995 GCGGGCCACCTGGAGGAGATGGG + Intergenic
903336420 1:22627490-22627512 CAGAGTCACCTGGGGGAGCTGGG - Intergenic
903371303 1:22837838-22837860 TGGGGTCACCAGGAAGACCGAGG + Intronic
903811982 1:26039693-26039715 TGGGGTCACCTGGACCCGTTGGG + Intronic
904314996 1:29654175-29654197 AGGGGTCACCAGATGGAGCTGGG + Intergenic
905924484 1:41740096-41740118 TGGGGAGACCTGGAGGACTTAGG - Intronic
906141755 1:43537878-43537900 TGGGGTCATGCTGAGGAGCTGGG + Intronic
906786896 1:48623874-48623896 TGGGGTAAACTGGAGTAGTTTGG + Intronic
907158612 1:52355762-52355784 TAGGGTTACCTGGAGGGGCTGGG + Exonic
907309098 1:53529240-53529262 CTGGGTCACCTGCAGGAGCCTGG + Intronic
907339928 1:53727631-53727653 AGGGGCCAGGTGGAGGAGCTTGG - Intronic
910342419 1:86203087-86203109 TGGGGACATCTGGAGGTGCTTGG + Intergenic
912336032 1:108863742-108863764 TGGGCTCACCTGGATAATCTAGG + Intronic
912422412 1:109552766-109552788 TGGGGTGAGCTGAAAGAGCTTGG - Intronic
913259236 1:116983337-116983359 TGCTGTCACCTGCAGGTGCTGGG - Intronic
913278081 1:117158462-117158484 TGGGCACAGCTGGAGCAGCTGGG + Intronic
913479775 1:119276831-119276853 TGGGCTCACCTGGATTATCTAGG + Intergenic
915074565 1:153297789-153297811 TGGGGGCTCCTGGAGGATGTTGG + Intergenic
915129746 1:153688112-153688134 CAGAGTCACCTGGAGGAGTTGGG + Exonic
915313519 1:155016150-155016172 TGGGATGACCAGGAGGAGCCAGG + Intronic
915901276 1:159848256-159848278 TTGGGGAATCTGGAGGAGCTGGG - Intronic
915972688 1:160365556-160365578 TGGGGGCAGGTGGGGGAGCTTGG + Intergenic
919611835 1:199754871-199754893 TGGAGGCAGCTGGAGGAGCCTGG - Intergenic
919773671 1:201179324-201179346 AGGAGTCACATGGAGGAGATGGG - Intergenic
919840883 1:201608717-201608739 TGGGGTCAGCTGGGGGAGGAGGG + Intergenic
922005628 1:221528001-221528023 TGATGTCAAGTGGAGGAGCTGGG + Intergenic
922811351 1:228416996-228417018 TGGGGACAGCTGGTGGGGCTAGG + Intergenic
923996787 1:239504758-239504780 TGTGGTGACCTGGATGAGATTGG + Intronic
1064745619 10:18475388-18475410 TGGGGTCTCCTGGAGAGCCTTGG - Intronic
1065111566 10:22445027-22445049 AGGAGTCACATGGAGGAGATGGG + Intronic
1067510159 10:46888053-46888075 TGGGAGCATGTGGAGGAGCTGGG + Intergenic
1070530507 10:77332639-77332661 TGGGGTCACCAGGCAGAGCTAGG + Intronic
1071554580 10:86592504-86592526 TGTGGACACCTAGAGGTGCTGGG - Intergenic
1072906438 10:99458324-99458346 TAGGGGAACCTGGAGGAACTGGG + Intergenic
1072922961 10:99592057-99592079 TGGGCTAACATGGTGGAGCTGGG + Intergenic
1073487115 10:103826510-103826532 TTTGATCACCTGCAGGAGCTGGG - Intronic
1073577801 10:104640454-104640476 TGGGGGCACCTGGCTGAGCCGGG - Intergenic
1076192043 10:128489865-128489887 TGGGGTCAGCTGGAAGATCTCGG - Intergenic
1076462985 10:130659046-130659068 TGGAGCCATCTGGAGGGGCTGGG + Intergenic
1076726731 10:132417348-132417370 TGGGGTTCCATGGAGGAACTGGG + Exonic
1076726748 10:132417405-132417427 TGGGGTCCCATGGAGGAACCAGG + Exonic
1076753924 10:132558252-132558274 CGGGGACACCCGGAGCAGCTTGG - Intronic
1080638893 11:34147071-34147093 TATGGTCACCTCGAGGGGCTTGG + Intronic
1083610713 11:64002898-64002920 TGGGGCTACCTGGTGGAGGTGGG + Intronic
1083668443 11:64287640-64287662 TGGGGTTTCCTGCAGGAGGTGGG + Intronic
1083967740 11:66052751-66052773 TAAGGTCTCCTGGAGAAGCTCGG - Intronic
1084473543 11:69376550-69376572 TGGGGTGGCCTCGAGGATCTTGG + Intergenic
1084494572 11:69496582-69496604 TGGGGACAACTGAAGGGGCTTGG + Intergenic
1084552141 11:69850965-69850987 TGGGGACAGGTGTAGGAGCTTGG + Intergenic
1085392789 11:76190997-76191019 TGGGGTCCCCAGGAGGAGATGGG + Intronic
1085527524 11:77172922-77172944 TAGGGTGACGTGGAGGAGCTAGG + Intronic
1085566412 11:77518290-77518312 TGGGGTCACCTGGAGAAGCATGG + Intronic
1086536575 11:87854055-87854077 TGGGCCCACCTGGATGATCTAGG + Intergenic
1089536218 11:119162082-119162104 TGGGATCCCCAGGAGGAGGTTGG - Exonic
1090247545 11:125227194-125227216 TGGAGTCACCTGGGGGAGGGAGG + Intronic
1091900836 12:4142711-4142733 AGGGGACACCTGGAAGAGCGCGG + Intergenic
1091995915 12:4993992-4994014 TGGGGTCCCCTAGAGAAGCTGGG - Intergenic
1091999263 12:5019158-5019180 TGGGGTCACATGCAGGAGCTGGG + Intergenic
1092282835 12:7110304-7110326 TAGGGTCACCTGGAGCACCTTGG + Intergenic
1093714122 12:22362124-22362146 TGGTCTCATCTGGAGGTGCTAGG - Intronic
1095747568 12:45676553-45676575 TGGGCTCACCTGGATAATCTGGG + Intergenic
1097088412 12:56486723-56486745 TGGGATTACCTCGAGTAGCTGGG - Intronic
1097959078 12:65514803-65514825 TGGGGTCTCCAGGAGTAGCAAGG + Intergenic
1098213273 12:68188356-68188378 AGGGGTCACCTGGATGTCCTGGG + Intergenic
1099290610 12:80772034-80772056 TGTGGTAACATGGATGAGCTTGG - Intergenic
1100052186 12:90461883-90461905 TGGCTTCATCTGGAGCAGCTGGG + Intergenic
1100430791 12:94530286-94530308 TGGGGTCAGCTGGAAGAGGAAGG - Intergenic
1102036578 12:109773774-109773796 TGGTGGCACCTGGAGGAGTGAGG + Intergenic
1103005333 12:117416277-117416299 TGGGGTCTCCTGGTGATGCTGGG - Intronic
1103851512 12:123936594-123936616 AGGGGTCTCCAGGAGGAGCTCGG + Exonic
1103893093 12:124254473-124254495 TCACGACACCTGGAGGAGCTTGG - Intronic
1104440501 12:128789744-128789766 TGGAGTCACCTGCGGGTGCTCGG - Intergenic
1104458938 12:128938502-128938524 TCTGGTCATCTGAAGGAGCTGGG + Intronic
1104841253 12:131827220-131827242 TGGGATCACCTGTAGGAGGTGGG - Intergenic
1104936635 12:132367977-132367999 TGGGGTCACTGGGAGTCGCTGGG - Intergenic
1104936646 12:132368016-132368038 TGGGGTCACTGGGAGTCGCTGGG - Intergenic
1105596277 13:21842393-21842415 TGCGGCCACATGGAGGAGCCTGG + Intergenic
1105821583 13:24085506-24085528 TGGGGACAGCTGCAGGAACTGGG + Intronic
1107658961 13:42619601-42619623 TGGGTTCACCTGTAGGAGTCAGG - Intergenic
1107960140 13:45550080-45550102 TGGGGTCCCCTGGAAAAGGTAGG + Intronic
1107987176 13:45785641-45785663 GGAGGTGACCTGGAGGAGGTAGG + Intronic
1108521994 13:51254658-51254680 AGGGGTCACCAGGAAGAACTGGG - Intronic
1109904242 13:68817238-68817260 TGGGCTCACCTGGAGTATCCAGG + Intergenic
1111292500 13:86187056-86187078 TGGGTGTACCTGGAGGAGCAGGG - Intergenic
1111388892 13:87564979-87565001 TGGGTCCCTCTGGAGGAGCTGGG - Intergenic
1115914944 14:38301764-38301786 TAGGGACACCTAGAGGAGCTTGG - Intergenic
1117676871 14:58164231-58164253 AGAGGTCACCTGGAGGTTCTTGG + Intronic
1117744390 14:58853460-58853482 TCTGGCCACCTGGAGAAGCTGGG - Intergenic
1118061985 14:62149652-62149674 TGCAGTGACCTGGAGGAGATTGG + Intergenic
1119674200 14:76541729-76541751 TGGTGGCACCTGGAGCACCTGGG - Intergenic
1119780508 14:77273944-77273966 TGGGTGCACCTGGGGGAGCCAGG + Intergenic
1121013471 14:90534949-90534971 TGGGGCCATCTGGAGGAGTCTGG + Exonic
1121027240 14:90625578-90625600 TAGGCTCACCTGGCGGAGGTCGG - Intronic
1121341628 14:93108512-93108534 TGCAGGCACCTGGAAGAGCTGGG - Intronic
1121367334 14:93325844-93325866 TGGGGACACTTGGAATAGCTAGG - Intronic
1121468990 14:94137417-94137439 TGGGATCACCTGGCAGAACTGGG - Intergenic
1121723720 14:96130641-96130663 TGGGGGCACCAGGGGGAGGTCGG + Intergenic
1121989336 14:98540051-98540073 TGGGGTGAGCTAGAGGAGGTGGG - Intergenic
1122449802 14:101796643-101796665 GGGGGTACCCTGGAGGGGCTGGG - Intronic
1122693685 14:103542914-103542936 TGAGGTCACCAGGAGGGGCCTGG - Intergenic
1122717084 14:103702292-103702314 TGAGGTCACCTGTCTGAGCTGGG + Intronic
1122860748 14:104581365-104581387 TGGTGGCCCCAGGAGGAGCTGGG - Intronic
1122871103 14:104639425-104639447 TGGGGTCTCCAGGGGGACCTGGG - Intergenic
1123098740 14:105779650-105779672 TGAGGTAACATGGATGAGCTTGG - Intergenic
1124200438 15:27674523-27674545 TGGGGCCACTTGGAGGTGATGGG + Intergenic
1124466030 15:29940859-29940881 GGGGGTCACTTGGAGGTGATTGG - Intronic
1124903461 15:33846053-33846075 TGGGCTCAGCTGGGGTAGCTGGG + Intronic
1125744641 15:41990033-41990055 TTGGGGGACCTGGAGGTGCTGGG + Intronic
1126390055 15:48138590-48138612 TGGAGACAACTGGAGTAGCTAGG + Exonic
1126572562 15:50167895-50167917 TGGATTCATCTGGAGGTGCTCGG + Intronic
1128124763 15:65184638-65184660 TGGGGGCTCCAGGAGGGGCTCGG - Intronic
1128552653 15:68608377-68608399 TGTGGTCCCCTGGAGGACTTCGG + Intronic
1130652621 15:85770724-85770746 TGGCGTCAGCTGGGGGACCTGGG - Intronic
1132659117 16:1053781-1053803 TGGGGTCAGTGGGAGGGGCTGGG - Intergenic
1132744021 16:1429302-1429324 TGGGGTCACCTGCAGGTCCCAGG - Intergenic
1133058334 16:3158571-3158593 TGGGGCCGCCTGGAGCCGCTGGG + Intergenic
1133506322 16:6415902-6415924 TGGGTTCACTTTGAGGACCTTGG + Intronic
1133545799 16:6805376-6805398 TGGGGTCTCCTGGAGGATAGAGG + Intronic
1133968145 16:10546617-10546639 ATGGGTCACCTGGAAGATCTAGG + Intronic
1137785273 16:51133271-51133293 AGGGGTCATCTCGAGCAGCTTGG + Intergenic
1138356936 16:56389622-56389644 AGGGGTCACAACGAGGAGCTTGG - Intronic
1138420025 16:56892939-56892961 TGGGGTCCACTGCAGGAGGTGGG - Exonic
1139387000 16:66579273-66579295 TGGGGCCACCTGGAGACGCCGGG + Intergenic
1140979623 16:80094473-80094495 TGGGGTGAGCTGGAGGAACGAGG - Intergenic
1141676795 16:85522028-85522050 TGGGGTCTCCTGGAGTTTCTAGG - Intergenic
1142214723 16:88824916-88824938 TGGGGCCACCTGGAGGCTCTGGG + Intronic
1143026537 17:3944819-3944841 GGCGGTCACCAGGAGGACCTCGG + Intronic
1144161603 17:12565952-12565974 TGTGGTGATGTGGAGGAGCTTGG + Intergenic
1144512908 17:15892718-15892740 TGGAGGCACCTAGAGGACCTCGG + Intergenic
1144813529 17:18017558-18017580 GGGGGTGACATGGTGGAGCTGGG - Intronic
1145123929 17:20284972-20284994 TGGAGGCACCTGGAGGTCCTTGG + Intronic
1145879552 17:28343440-28343462 TGGAGGCACCTGGAGTAGTTTGG - Intronic
1145905598 17:28514566-28514588 AGGGGTCCCCTGGAGCAGCTCGG - Intronic
1146469310 17:33111485-33111507 TGGGGGAAGCTGGAGGGGCTGGG - Intronic
1146951166 17:36907569-36907591 TGGGCACAGCGGGAGGAGCTGGG - Intergenic
1147020357 17:37526798-37526820 TGGGGTCACCTGGATAATCCAGG + Intronic
1147186937 17:38718003-38718025 TGGGGTCACATGCAGGTGATGGG - Intronic
1148243183 17:46013214-46013236 TGGGGTCACCTGAGGGTGCAAGG - Intronic
1148805365 17:50261176-50261198 AGGGGTGACCAGGAGGAGCCCGG + Intergenic
1150007055 17:61476501-61476523 TGGAGTCACCTAAAGGGGCTGGG + Intronic
1151215151 17:72572000-72572022 TGTGGTGACCCCGAGGAGCTGGG - Intergenic
1151576131 17:74953435-74953457 TGGGGTCACCTGCAGCAGAGGGG - Intronic
1151951795 17:77358503-77358525 TGGGTTCTCCTTGAGTAGCTGGG - Intronic
1151966451 17:77434116-77434138 TGGGGTCTCCAGGAGGCCCTTGG + Intronic
1152567395 17:81106429-81106451 TGGGAGAACCTGGAGGACCTGGG - Intronic
1152703590 17:81831926-81831948 TTGGGTCCCCTGGAGGAGGAAGG - Intronic
1152734810 17:81992176-81992198 TGGGGTCCCCGGGAGGCCCTGGG + Intronic
1156293922 18:35773289-35773311 TGGGGACACCTGGAGGATGGAGG - Intergenic
1157757602 18:50232442-50232464 TAGGGAAACCTGGAGGGGCTGGG - Intronic
1157819350 18:50754123-50754145 CTGGGTCAGCTGGAGGATCTGGG - Intergenic
1157905372 18:51564747-51564769 TGGGCTCTCCTAGAGGAACTTGG + Intergenic
1157967761 18:52227602-52227624 TTGGGTTTCCTGCAGGAGCTGGG - Intergenic
1158003102 18:52642167-52642189 TGCGGTGACCTGGATGAGATTGG + Intronic
1158099920 18:53819256-53819278 TGAAGCCACCTGGAGGAGCATGG - Intergenic
1159908070 18:74116637-74116659 AGGGCACACCAGGAGGAGCTGGG - Intronic
1160018888 18:75165236-75165258 TGGGGTATCCTGTAAGAGCTGGG + Intergenic
1160018905 18:75165347-75165369 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018914 18:75165403-75165425 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018922 18:75165459-75165481 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018937 18:75165571-75165593 TGGGGTATCCTGTAAGAGCTGGG + Intergenic
1160018944 18:75165608-75165630 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018955 18:75165683-75165705 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018962 18:75165720-75165742 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018966 18:75165739-75165761 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018973 18:75165776-75165798 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018983 18:75165851-75165873 TGGGGTATCCTGTATGAGCTGGG + Intergenic
1160018990 18:75165889-75165911 TGGGGTATCCTGTATGAGCTAGG + Intergenic
1160067837 18:75594071-75594093 TGGGCTCACCTGGAGAATCCAGG - Intergenic
1160076088 18:75679227-75679249 TGGGGTCACCTGAAGGAACAGGG - Intergenic
1160754578 19:750900-750922 CGGGGCCACCTGGAGGCCCTGGG + Intergenic
1161428688 19:4218104-4218126 GAGGGGCAGCTGGAGGAGCTGGG + Exonic
1161785074 19:6319463-6319485 TGATGTCACCTGCTGGAGCTGGG - Intronic
1161815023 19:6494693-6494715 TGGGGTCAGAGGTAGGAGCTGGG + Exonic
1162403877 19:10461986-10462008 TGGGGGCACCTGGATGCGGTCGG - Exonic
1162549153 19:11348894-11348916 TGGGGACACTGGGAGGGGCTGGG + Intronic
1163291804 19:16384004-16384026 GGGGGTCCCCTGGAGCAGCTGGG - Intronic
1163609248 19:18292506-18292528 TCCGGCGACCTGGAGGAGCTGGG - Intergenic
1163986830 19:20961423-20961445 TGGGAGCACCTGGAGAAGATGGG + Intergenic
1164552482 19:29223299-29223321 AGGGGGCAGGTGGAGGAGCTGGG - Intergenic
1164835779 19:31354281-31354303 TTGGGCCACCTGGAGGGACTGGG + Intergenic
1165444836 19:35851061-35851083 TGGGGTCAGCAGGAGCAGCTTGG + Exonic
1166445600 19:42855480-42855502 TGGGGTCTCCTGGAGAGGATGGG - Intronic
1166448598 19:42879442-42879464 TGGGGTCTCCTGGAGAGGATGGG - Intronic
1166471401 19:43082430-43082452 TGGGGTCTCCTGGAGAGGATGGG - Intronic
1166485026 19:43205397-43205419 TGGGGTCTCCTGGAGAGGATGGG - Intronic
1166492168 19:43269292-43269314 TGGGGTCTCCTGGAGAGGATGGG - Intronic
1166644143 19:44518778-44518800 TGGGGAGACCAGGAGGAGCTGGG - Intronic
1167169461 19:47821696-47821718 TATGGTCACCGGCAGGAGCTGGG + Intronic
924985325 2:264651-264673 TGGGGTCACCTGGAGGGAGTAGG - Intronic
925763516 2:7209232-7209254 TGGGGTCACATGGGCAAGCTTGG - Intergenic
926055425 2:9771403-9771425 GGGGGCCACCTAGAGGAGCTGGG - Intergenic
927102739 2:19800367-19800389 TGGGATCTCCTGGTGGAGCTGGG - Intergenic
927938288 2:27087361-27087383 TGGGGTCCCCTAGGGGACCTGGG - Intronic
928178765 2:29053083-29053105 TGGGCTCCCCTGCAAGAGCTGGG - Exonic
928258020 2:29741879-29741901 TGGGGTCAAGAAGAGGAGCTGGG + Intronic
928444464 2:31320652-31320674 TGGGTGCACCTGGATGATCTGGG - Intergenic
929234394 2:39590954-39590976 TTGGGTCACCAGGAGAATCTTGG + Intergenic
929917126 2:46145302-46145324 TGGGGTCATCTAGTGGTGCTGGG + Intronic
929957717 2:46471425-46471447 TGGATTCAACTGGGGGAGCTTGG - Intronic
930232601 2:48858118-48858140 GGGAGTCACCAGCAGGAGCTGGG + Intergenic
930552351 2:52851920-52851942 TGCGGTCATCTGGAGGAGAAGGG + Intergenic
931026166 2:58115351-58115373 TGAGTTCAGCTGAAGGAGCTGGG + Intronic
931042842 2:58317479-58317501 TGAGTTCAGCTGAAGGAGCTGGG - Intergenic
933700188 2:85249552-85249574 TGGGGTCACCTTGAGAAGAGGGG - Intronic
935172184 2:100618864-100618886 TGCGGTGACCTGGATGAGATTGG - Intergenic
935217825 2:100988719-100988741 AGGGGGCGCCTGGAGGAGCAGGG - Intronic
936075271 2:109397734-109397756 CGGCATCACCTGGAGGGGCTGGG - Intronic
936944687 2:117919735-117919757 GGCTGGCACCTGGAGGAGCTGGG + Exonic
937872909 2:126798687-126798709 TGGGGACCCCTGCAGGAGCAGGG - Intergenic
937912821 2:127084265-127084287 CCGGGTCACGTGGAGGAGATTGG - Intronic
938310532 2:130285933-130285955 TTGGGCCCCCTGGAGGAGCAGGG + Intergenic
938444393 2:131366434-131366456 TTGGGTCCCCTGGGGGAGCAGGG - Intergenic
942798272 2:179846825-179846847 TGGACTCACCTAGAGCAGCTAGG + Intronic
944230480 2:197387071-197387093 TGAGGTCACCTGGGGGAGCCAGG - Intergenic
944681053 2:202077086-202077108 TGGGGTCACCTGGAGGAGCTGGG - Intronic
946251944 2:218419247-218419269 TGGGGCCTCCTGGAGCACCTTGG + Intronic
946776274 2:223144891-223144913 TGTGGTCCTATGGAGGAGCTGGG - Intronic
947090641 2:226507618-226507640 TTGGGTCACTTGGAGAAGGTTGG - Intergenic
948292270 2:236834685-236834707 GTGGGTCACTTGGTGGAGCTGGG - Intergenic
948359949 2:237412983-237413005 TGGGGTCACTGGGAGGGACTAGG - Intronic
1169252689 20:4072436-4072458 TGGAGAAACCTGGAGGAGCTCGG + Intronic
1169364555 20:4981450-4981472 TGGAATCACCTGGAAGTGCTCGG + Intronic
1170473187 20:16688593-16688615 TGTGGGCGCCAGGAGGAGCTGGG + Intergenic
1171178565 20:23074409-23074431 TGTGGTCATCTGGAAGTGCTGGG + Intergenic
1174534038 20:51237125-51237147 TAGGATCTTCTGGAGGAGCTGGG + Intergenic
1174551916 20:51368333-51368355 TGAGATCACCTGGATGATCTGGG - Intergenic
1175457336 20:59125373-59125395 TGGGGCCACTTGGAGGAGCAGGG - Intergenic
1175457471 20:59126375-59126397 TGGGACCACTTGGAGGAGCAGGG - Intergenic
1175486917 20:59353442-59353464 TGGGGTGTCCTGGAGGAGAGGGG + Intergenic
1176142858 20:63552948-63552970 TGGGGTCACCGGGAGGAGGGGGG + Intronic
1176146808 20:63569119-63569141 TGGGGGCAACAGGAGCAGCTGGG - Intronic
1176205259 20:63884787-63884809 TGGGGCCAGCTGGGGGAGCGGGG + Intronic
1176222201 20:63975053-63975075 TGGGCCAACCTGGAGGTGCTGGG + Exonic
1177407441 21:20688765-20688787 TGGTTTCAGATGGAGGAGCTGGG + Intergenic
1178975530 21:37218061-37218083 TGGGGCCACCTGGGGAGGCTGGG - Intergenic
1180068680 21:45425356-45425378 TGGGCTCCCCTGGAGGACCCTGG + Intronic
1180612621 22:17107863-17107885 TGGGGTCTCCTGAAGGGACTTGG - Intronic
1182124920 22:27809393-27809415 TGCTGACACATGGAGGAGCTTGG - Intergenic
1182344813 22:29654915-29654937 TGGGGTCACCAGGACTAGCATGG + Intronic
1182578847 22:31291664-31291686 TAGGGTCCCTTTGAGGAGCTGGG + Intronic
1183409291 22:37645512-37645534 TGGGGTCCCCTGGGGCAGGTGGG + Intronic
1184717213 22:46289013-46289035 AGGGCTGACCTGGAGGACCTGGG + Intronic
1185053830 22:48567691-48567713 CGAGCTCACCCGGAGGAGCTTGG - Intronic
1185156050 22:49194150-49194172 TGGGATCCCCCGGAGGAGGTGGG - Intergenic
1185248964 22:49789651-49789673 GGGGGTCTCCCGGAGGTGCTGGG - Intronic
950280030 3:11698961-11698983 TTAGGTCACCTTGATGAGCTGGG + Intronic
950663823 3:14482902-14482924 TGGGGTCACCTGGAGGGCTCGGG - Intronic
953157189 3:40386271-40386293 TGGGGTCACTCAGAGGAGCCGGG + Intergenic
953403398 3:42646891-42646913 TGGGGTCCCCTGGAGCAGGCAGG + Exonic
953641331 3:44711067-44711089 TGGGGGCATCCGGTGGAGCTGGG - Intergenic
954697466 3:52435437-52435459 TGGGGTCTAATGGAGGGGCTGGG - Exonic
956584815 3:70852979-70853001 TGGAGTCACCTGGGCGTGCTGGG - Intergenic
956834831 3:73088348-73088370 TGGGGCCACCTTTGGGAGCTGGG + Intergenic
959668113 3:108943920-108943942 TGGAGTGACCTGGATGAGATTGG - Intronic
961365629 3:126397767-126397789 TGGGGTCAGCTGCAGGAGCTGGG + Intronic
961391213 3:126553248-126553270 TGGGGTGACCTGGGGGAGGCAGG + Intronic
961569757 3:127789188-127789210 TGTGGTGGCCAGGAGGAGCTGGG + Intronic
962482079 3:135806638-135806660 GGGGCTCTCTTGGAGGAGCTGGG + Intergenic
962812834 3:138973864-138973886 TGGGGCCAGCTGGAGGAGTTTGG - Intergenic
963535347 3:146521675-146521697 TTGGTACACCAGGAGGAGCTTGG + Exonic
966747863 3:183295578-183295600 GGGGGTCACCTGAGGGAGGTAGG - Intronic
967986084 3:195096218-195096240 TGGGGCCACCTAGGGGAGATTGG + Intronic
968299748 3:197603520-197603542 TGGGACTACCTGGAGCAGCTTGG + Intergenic
968900434 4:3429003-3429025 TGGGGCCATAGGGAGGAGCTGGG - Intronic
969605533 4:8200433-8200455 TCGGCTCACCTGGAGGAGGGAGG - Intronic
969832824 4:9811586-9811608 TGGTGTCAGCTGGAGGTGATTGG - Intronic
969885479 4:10211602-10211624 TGGAGTCACCTGTAGAAACTAGG + Intergenic
970531390 4:16989021-16989043 TGATGTCACCTGGAGGACCTTGG - Intergenic
970628084 4:17912034-17912056 TGGGGGCACCTGGAGAAGAAGGG + Intronic
976361589 4:84185098-84185120 TGGGGTTGTCTGGAAGAGCTGGG + Intergenic
979342404 4:119541845-119541867 CAGAGTCACCTGGGGGAGCTTGG + Intronic
980566749 4:134552323-134552345 TGGGGTCAGCTGGTGGAATTTGG + Intergenic
981485933 4:145286071-145286093 TGGTGCCACCTGGATGATCTGGG - Intergenic
982189281 4:152837074-152837096 TGGAGTGACCTGGATGAGATTGG - Intronic
983374586 4:166909378-166909400 TGAGGTCAGGTGCAGGAGCTGGG - Intronic
984094066 4:175412265-175412287 GGGGAGCACCTGGAGGAGTTTGG - Intergenic
984206349 4:176792412-176792434 GGGGGTCGCCGGGAGGAGCCCGG - Exonic
984349032 4:178568461-178568483 TGGGGCGACGTGGAGGAGCAAGG - Intergenic
984995490 4:185426332-185426354 TGGGGCAACCTGGACGAGCTGGG + Intronic
985652988 5:1115657-1115679 AGGGGACACCTGGAGGAGGCCGG + Intergenic
986249575 5:6044221-6044243 AGGTGCCTCCTGGAGGAGCTCGG + Intergenic
986669711 5:10132112-10132134 TGTGGTGACCTGGATGAGATTGG + Intergenic
986773462 5:10994256-10994278 TGGGGGGAGATGGAGGAGCTGGG + Intronic
988199358 5:28049632-28049654 TGGGTACAGCTGAAGGAGCTGGG - Intergenic
988482691 5:31642826-31642848 TGGGGTCACTTCGTGAAGCTGGG + Intronic
988520000 5:31937281-31937303 TGGGCTAACATGGAGGAGGTTGG + Intronic
988636050 5:32986197-32986219 TGCGGTAACCTGGATGAGGTTGG + Intergenic
994153334 5:96474627-96474649 TGGGGTGTCCAGGAAGAGCTCGG + Intergenic
995498188 5:112772120-112772142 GGGGGTCACCTAGAAGAGCATGG - Intronic
997761335 5:136451177-136451199 TGCGGTGACCTGGATGAGATTGG + Intergenic
998134025 5:139665359-139665381 TGGGGGCACCGGGATGAGCTGGG + Intronic
999737472 5:154523462-154523484 TGGGGTCACCTTGGCTAGCTGGG - Intergenic
1000895174 5:166846592-166846614 TGGGGCCACCTGCACGACCTAGG + Intergenic
1001081709 5:168672172-168672194 TGGGTGCACCTGGAGCAGGTGGG + Intronic
1003083114 6:3038105-3038127 TAGGGAAACCTGGAGAAGCTGGG - Intergenic
1003332073 6:5137454-5137476 TGGGGCCAACTCCAGGAGCTTGG - Intronic
1006432743 6:34007830-34007852 GAGGGTCACCTGGAGGTGCCTGG + Intergenic
1007108356 6:39298459-39298481 TAGGTTCACCTGGGGCAGCTGGG - Intergenic
1007348084 6:41248144-41248166 TGGGTTCCACTGGAGGATCTGGG + Intergenic
1008019480 6:46559665-46559687 TGGTAGCACGTGGAGGAGCTGGG + Intronic
1008432360 6:51434305-51434327 CGTGATCACCTGGAGGAGCTCGG + Intergenic
1013775395 6:113673629-113673651 GAGGGGCCCCTGGAGGAGCTGGG + Intergenic
1014209879 6:118697186-118697208 TAAAGTCACATGGAGGAGCTTGG + Intronic
1018387957 6:163321977-163321999 GGGGGTCAGCTGGGGGAGCCAGG - Intergenic
1019143200 6:169961198-169961220 TGGGTTCCCCTGGAGGATGTGGG + Intergenic
1019299503 7:296228-296250 TGAGGGCACCAGGAGGGGCTGGG - Intergenic
1019508055 7:1403400-1403422 TGGTGTCTCCTGGAGGCCCTGGG - Intergenic
1019921292 7:4164777-4164799 TAGTGCCACCTGGAGGAGCTGGG + Intronic
1020009614 7:4800850-4800872 TGGGGCCACCTGGCCAAGCTGGG - Intronic
1020081019 7:5285571-5285593 TGGGGTCACAGGGAGGTGCTTGG + Intronic
1021506478 7:21391068-21391090 TGGGTTGACCTAAAGGAGCTTGG + Intergenic
1022115697 7:27258642-27258664 CAGGATCACCTGGGGGAGCTTGG - Intergenic
1022972144 7:35528170-35528192 CCAGGTGACCTGGAGGAGCTTGG + Intergenic
1024067408 7:45752201-45752223 TGAGGTCAGCTGGAGAATCTAGG - Intergenic
1025197892 7:56946595-56946617 TCGGGTCACAGGGAGGTGCTTGG - Intergenic
1025674056 7:63630340-63630362 TCGGGTCACAGGGAGGTGCTTGG + Intergenic
1028275277 7:88848298-88848320 TGGGGGCAGAAGGAGGAGCTGGG + Intronic
1029172647 7:98641826-98641848 TGTGGTCACCTGCAGGACCGGGG - Intergenic
1029222388 7:99000726-99000748 TGGGGTGTCCTGAAGGAGCAGGG + Intronic
1031302205 7:120075253-120075275 TGTGGCCACATGGATGAGCTTGG + Intergenic
1033330723 7:140414882-140414904 TGGGGACATTAGGAGGAGCTGGG - Intronic
1033657049 7:143381477-143381499 GGGGGTCACCAAGGGGAGCTGGG + Intronic
1034787306 7:153937056-153937078 TAGGGTCCCATGGAGGACCTTGG + Intronic
1035299093 7:157885513-157885535 TGGGGCCAGCAGGAGGAACTTGG - Intronic
1035315083 7:157992643-157992665 GGGGGTCCCCTGGAGGGGTTGGG + Intronic
1037969829 8:23164131-23164153 TGGGCCCTCCTGGAGGTGCTGGG - Intergenic
1039469306 8:37803572-37803594 TGGGGGCCCCTGGAGGAGGGAGG - Intronic
1039845778 8:41324503-41324525 TGAGGTCTCCTCCAGGAGCTGGG - Intergenic
1040499760 8:47996210-47996232 TGGGGTCACGGTGAGCAGCTAGG + Intergenic
1041382225 8:57261675-57261697 TGGGGGCTACTGGAGGAGGTGGG + Intergenic
1043614805 8:82112828-82112850 TGGGGTGAGCAGCAGGAGCTAGG - Intergenic
1045121718 8:99044782-99044804 TGTAGTGACCTGGAGGAGATTGG - Intronic
1047105568 8:121727249-121727271 TGGGGTCACCTGGAGACTTTGGG - Intergenic
1049274078 8:141711064-141711086 TGGGAGGACCTGGAGGGGCTGGG + Intergenic
1049423591 8:142527420-142527442 TGGGGACAGCAGGAGGAGCCAGG - Intronic
1050922370 9:11220369-11220391 TGGGGTGCCCTGAAGGGGCTTGG + Intergenic
1051366191 9:16323144-16323166 TAGGGTCTCCTTGAGGACCTTGG + Intergenic
1052062419 9:23976857-23976879 TGGAGTTACCTGGAAGGGCTCGG + Intergenic
1054927123 9:70600649-70600671 TGTGGCCACCAGCAGGAGCTGGG - Intronic
1055665592 9:78549757-78549779 TGGGCTCACCTGGATGAGCCAGG - Intergenic
1059106533 9:111516608-111516630 TGGGAGCAACTGGAGGAGCAAGG - Intergenic
1060729994 9:126031088-126031110 TGGGGGCACCTGCTGCAGCTAGG + Intergenic
1060892639 9:127198505-127198527 TGGGGTCACAGAGAGGGGCTGGG - Intronic
1061134432 9:128725018-128725040 AGGAGTATCCTGGAGGAGCTGGG - Intergenic
1061175436 9:128993183-128993205 TGGGGCCACCTGGTGGAGACCGG - Exonic
1061198619 9:129122965-129122987 TTTGGTAACCTGGTGGAGCTCGG + Intronic
1061856204 9:133443234-133443256 TGGGAACACCTGGAGAGGCTAGG + Intronic
1061899595 9:133666147-133666169 CAGGGTCACCTGGAGGGGGTGGG + Intronic
1062355093 9:136158163-136158185 TGGAGCCACCTGGAGCCGCTGGG - Intergenic
1185615541 X:1419578-1419600 TGGGGGGACTTGGAGAAGCTCGG - Intronic
1186466389 X:9786833-9786855 TGGGGTCACCTGCCGGGCCTGGG + Intronic
1186511747 X:10134935-10134957 TGGGTTGAGCTGGAGGAGCCGGG + Intronic
1189005462 X:36989348-36989370 AGAGGTCACCTGGAAGTGCTTGG + Intergenic
1189043564 X:37568588-37568610 AGAGGTCACCTGGAAGTGCTTGG - Intronic
1189069408 X:37847646-37847668 TGGCGTCACCTGGCAGCGCTGGG + Intronic
1189069876 X:37851933-37851955 TGAGGTAAACTGGAGGGGCTTGG + Intronic
1189535879 X:41934902-41934924 TGGGGTAACATGGAGGTGGTAGG + Intergenic
1193583610 X:83294269-83294291 TGGGGTCATGTGAAGGAGCCAGG - Intergenic
1193926160 X:87487882-87487904 TGGGCTCACCTGGGGGAACTTGG + Intergenic
1194077586 X:89415919-89415941 TGGGGTCTACTTGAGGAGGTAGG + Intergenic
1194995332 X:100586011-100586033 TGGGGTCATTTGGTGAAGCTTGG + Intronic
1195556964 X:106237930-106237952 TGTGGTGACCTGGATGAGGTTGG + Intergenic
1197954385 X:131930638-131930660 TTTGCTCTCCTGGAGGAGCTTGG + Intergenic
1199059126 X:143332298-143332320 TGTGGTCACATGGAGGAAGTTGG + Intergenic
1200181851 X:154155575-154155597 TGGGGCCACATTGTGGAGCTGGG - Intronic
1200187500 X:154192689-154192711 TGGGGCCACATTGTGGAGCTGGG - Intergenic
1200430235 Y:3071463-3071485 TGGGGTCTACTTGAGGAGGTAGG + Intergenic