ID: 944681948

View in Genome Browser
Species Human (GRCh38)
Location 2:202085255-202085277
Sequence CCTCTCAGGTCCCAGGGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 0, 2: 2, 3: 83, 4: 559}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944681948_944681958 11 Left 944681948 2:202085255-202085277 CCTAATCCCTGGGACCTGAGAGG 0: 1
1: 0
2: 2
3: 83
4: 559
Right 944681958 2:202085289-202085311 AGGGAAATCAAGGTTGCCGATGG 0: 1
1: 1
2: 4
3: 67
4: 297
944681948_944681959 19 Left 944681948 2:202085255-202085277 CCTAATCCCTGGGACCTGAGAGG 0: 1
1: 0
2: 2
3: 83
4: 559
Right 944681959 2:202085297-202085319 CAAGGTTGCCGATGGAATTAAGG 0: 1
1: 1
2: 61
3: 166
4: 335
944681948_944681957 1 Left 944681948 2:202085255-202085277 CCTAATCCCTGGGACCTGAGAGG 0: 1
1: 0
2: 2
3: 83
4: 559
Right 944681957 2:202085279-202085301 TACAGGGCAAAGGGAAATCAAGG 0: 1
1: 2
2: 22
3: 115
4: 553
944681948_944681956 -8 Left 944681948 2:202085255-202085277 CCTAATCCCTGGGACCTGAGAGG 0: 1
1: 0
2: 2
3: 83
4: 559
Right 944681956 2:202085270-202085292 CTGAGAGGTTACAGGGCAAAGGG 0: 1
1: 0
2: 2
3: 18
4: 307
944681948_944681955 -9 Left 944681948 2:202085255-202085277 CCTAATCCCTGGGACCTGAGAGG 0: 1
1: 0
2: 2
3: 83
4: 559
Right 944681955 2:202085269-202085291 CCTGAGAGGTTACAGGGCAAAGG 0: 1
1: 0
2: 1
3: 13
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944681948 Original CRISPR CCTCTCAGGTCCCAGGGATT AGG (reversed) Intronic
900717919 1:4156999-4157021 ATTCACAGGTGCCAGGGATTAGG - Intergenic
900872567 1:5314522-5314544 ACTCACAGGTTCTAGGGATTAGG + Intergenic
900890924 1:5449193-5449215 CTTCACGGGTCCTAGGGATTAGG - Intergenic
902265549 1:15260905-15260927 ACTCACGGGTTCCAGGGATTAGG + Intronic
902275821 1:15338570-15338592 ACCCACAGGTTCCAGGGATTCGG + Intronic
902541005 1:17154706-17154728 GTTCACAGGTTCCAGGGATTAGG + Intergenic
902630425 1:17701446-17701468 GTTCTCAGGCCCCAGTGATTCGG + Intergenic
902699991 1:18165513-18165535 ATTCTGAGGTCCCGGGGATTAGG + Intronic
902960276 1:19958387-19958409 CTTCACAGGTTGCAGGGATTAGG + Intergenic
903506571 1:23839891-23839913 CCTCCCAGGTTCAAGTGATTGGG + Intergenic
904117863 1:28175642-28175664 CCTATCAGGTCCCAGGTGCTGGG - Intronic
904866519 1:33583481-33583503 CCCCTCAGGTCCCATGGCCTTGG + Intronic
905227816 1:36491351-36491373 ATTCACAGGTTCCAGGGATTAGG - Intergenic
905674190 1:39813956-39813978 CCTCCCAGGTTCAAGGGACTTGG + Intergenic
905854301 1:41297486-41297508 CCTCTCAGAGGCCAGGGTTTGGG + Intergenic
905979356 1:42210089-42210111 CCACTCAGCTCCCACGGACTTGG - Intronic
906071027 1:43016524-43016546 ATTCACAGGTTCCAGGGATTAGG - Intergenic
906688357 1:47777088-47777110 CATCTCAGAGCCCAGGCATTAGG - Intronic
908696490 1:66848449-66848471 ATTCACAGGTTCCAGGGATTGGG + Intronic
910246573 1:85144787-85144809 ATTCACAGGTTCCAGGGATTAGG + Intergenic
910282689 1:85518747-85518769 ACTCACAGGTTCCAGGGATTTGG + Intronic
910766752 1:90789857-90789879 ACTCACAGGTCCCAGGGTATAGG - Intergenic
913142313 1:115953805-115953827 ACTCATAGGTTCCAGGGATTAGG - Intergenic
914207323 1:145544233-145544255 ACTGACAGGTTCCAGGGATTTGG - Intergenic
915364207 1:155305095-155305117 CCTGTAAGGTCCAAGGGATAGGG - Intergenic
915493229 1:156263349-156263371 CCTGTCAGGTCCCAGGGTCTTGG - Intronic
916358222 1:163937016-163937038 ACTGACAGGTTCCAGGGATTAGG + Intergenic
916740161 1:167640516-167640538 ATTCACAGGTTCCAGGGATTAGG + Intronic
918589988 1:186230437-186230459 ATTCACAGGTTCCAGGGATTAGG - Intergenic
918798299 1:188935642-188935664 ATTCACAGGTCCCAAGGATTAGG - Intergenic
919067185 1:192707460-192707482 ACTCTGAGGTACTAGGGATTGGG - Intergenic
921493424 1:215807021-215807043 AGTCACAGGTTCCAGGGATTAGG - Intronic
921701580 1:218274564-218274586 ATTCACAGGTTCCAGGGATTAGG - Intergenic
922064782 1:222126141-222126163 ACTCACAGGCCCCAGGGGTTAGG + Intergenic
922340246 1:224649093-224649115 AGTCTCAGGTTCCAAGGATTAGG - Intronic
922932601 1:229402177-229402199 GTTCACAGGTTCCAGGGATTAGG + Intergenic
923057471 1:230437772-230437794 ATTCACAGGTTCCAGGGATTAGG + Intergenic
923812765 1:237338083-237338105 CGTCACAGGTGCCAGGGATTAGG + Intronic
924319501 1:242834497-242834519 CCCTTCAAGTTCCAGGGATTAGG - Intergenic
924444507 1:244116730-244116752 ATTTACAGGTCCCAGGGATTAGG - Intergenic
1062976973 10:1691060-1691082 CTTCTGAGGTCCTGGGGATTAGG - Intronic
1063124823 10:3128778-3128800 ATTCCCAGGTTCCAGGGATTAGG + Intronic
1063133677 10:3198795-3198817 AATCTGAGGTCCCAGGGGTTGGG - Intergenic
1065020166 10:21496407-21496429 CCTCTGAGGTCCCCGGGAAGAGG + Intronic
1066078172 10:31902009-31902031 ATTCACAGGTTCCAGGGATTAGG + Intronic
1066674408 10:37873311-37873333 AGTCACAGGTTCCAGGGATTAGG + Intergenic
1067237388 10:44462475-44462497 ACTCACAGGTACCAGGGGTTAGG - Intergenic
1067284773 10:44899522-44899544 ACTCACAGGTGCCGGGGATTAGG - Intergenic
1067576904 10:47414819-47414841 CCTCTCAGGTCCAGGGGATCTGG + Intergenic
1067776868 10:49170511-49170533 CCTCTTTGGGGCCAGGGATTAGG - Intronic
1069693146 10:70367679-70367701 ACTCCCAGGTACCAGGGATGGGG + Intronic
1070090921 10:73284433-73284455 AGTTCCAGGTCCCAGGGATTAGG + Intronic
1070972800 10:80581417-80581439 ATTCTGAGGTCCCGGGGATTAGG - Intronic
1071231254 10:83588713-83588735 CCTCCCAGGTCCTGAGGATTTGG + Intergenic
1071730924 10:88247666-88247688 GCTCTCAGGTTCCAGGGATTAGG - Intergenic
1072051868 10:91712798-91712820 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1073423761 10:103443771-103443793 CCTCTCAGGTCTCTAGCATTAGG + Intronic
1073591175 10:104758974-104758996 ATTCTCAGGTGCCAGGGATTAGG - Intronic
1074476036 10:113775286-113775308 TCTTTCAGGTCCCAGGACTTGGG + Intronic
1074670728 10:115787727-115787749 ATTCACAGGTCCCAGAGATTAGG - Intronic
1074685621 10:115959975-115959997 TCTCCCAGGTTCCTGGGATTAGG - Intergenic
1075671775 10:124267999-124268021 CCTCTGGGGACCCAGGAATTTGG + Intergenic
1075803898 10:125171324-125171346 ATTCACAGGTACCAGGGATTAGG + Intergenic
1075998706 10:126898112-126898134 ACTCTCAGGTACTGGGGATTAGG + Intergenic
1076114249 10:127884482-127884504 CCTCTCTGGCCCCAGGGAAGTGG - Intronic
1076281551 10:129250749-129250771 ATTCGCAGGTTCCAGGGATTAGG + Intergenic
1076413430 10:130267756-130267778 ACTCACAGGTTTCAGGGATTCGG + Intergenic
1076637410 10:131891479-131891501 TGTCACAGGTCCTAGGGATTGGG + Intergenic
1077163875 11:1126469-1126491 CCTCCCAGGTCCCAGGGTTCAGG + Intergenic
1077205827 11:1343662-1343684 CCTCTGAGGTCCTGGGGATCAGG + Intergenic
1077405889 11:2382367-2382389 CCTCTCAGGCCCCTAGCATTTGG - Intronic
1078453887 11:11460207-11460229 ATTCACAGGTTCCAGGGATTAGG + Intronic
1079417417 11:20252467-20252489 CATTACAGGTCCCAGGAATTAGG + Intergenic
1080181928 11:29435811-29435833 CTTCCCAAGTTCCAGGGATTGGG + Intergenic
1080709669 11:34734698-34734720 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1080799234 11:35594104-35594126 ATTCACAGGTTCCAGGGATTAGG + Intergenic
1081533028 11:43977221-43977243 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1081678154 11:44983012-44983034 GTTCGCAGATCCCAGGGATTAGG - Intergenic
1083087554 11:60165879-60165901 ACTCTCAGATTCCAGGGAGTAGG - Intergenic
1083470369 11:62880399-62880421 CCTCTCAGGCCTCTGGGACTTGG - Intronic
1083708101 11:64530422-64530444 ATTCGCAGGTTCCAGGGATTAGG - Intergenic
1084151896 11:67291533-67291555 CCTCTGGGCTCCCAGGGATTTGG + Intronic
1084309210 11:68306567-68306589 ATTCACAGGTCCCAGGGATTAGG + Intergenic
1084666603 11:70579707-70579729 TCACACAGGTCCCAGGGATTAGG - Intronic
1084683533 11:70680660-70680682 ACTCACAGGCCCCAGGGGTTAGG + Intronic
1085316689 11:75549316-75549338 ACTCACAGGTTCCAGGAATTCGG - Intergenic
1085350519 11:75795452-75795474 CCTCTCATGACTCAGGGTTTAGG + Intronic
1085660385 11:78359848-78359870 ATTCACAGGTTCCAGGGATTAGG - Intronic
1086021413 11:82234662-82234684 TTTCACAGGTTCCAGGGATTAGG + Intergenic
1086121077 11:83304953-83304975 ATTCATAGGTCCCAGGGATTAGG - Intergenic
1086412564 11:86557277-86557299 GATTTCAGGTCTCAGGGATTAGG - Intronic
1087079020 11:94152053-94152075 CCTTTTATGTGCCAGGGATTAGG + Intronic
1088574814 11:111260367-111260389 ACTCACCGGTCCCAGGGATTTGG - Intronic
1089372521 11:117971456-117971478 ACTCACAGGTTCAAGGGATTAGG - Intergenic
1089567267 11:119378377-119378399 CCTCTCAGGCCCCAGGGCCTGGG + Intronic
1089625315 11:119747437-119747459 ATTCACAGGTCCCAGGGATTAGG + Intergenic
1090445494 11:126761352-126761374 CCTCACAGGCCCCAGCGAGTAGG - Intronic
1090748073 11:129723185-129723207 CCTCTGAGGTCCCAAGCACTGGG - Intergenic
1091164761 11:133465387-133465409 GTTCACAGGTCCCAGGGATTAGG + Intronic
1091334241 11:134754551-134754573 CTTCACAGGTCCTGGGGATTAGG + Intergenic
1091783553 12:3229104-3229126 ATTCACAGGTTCCAGGGATTAGG + Intronic
1092856145 12:12675445-12675467 ATTCACAGGTTCCAGGGATTAGG - Intronic
1092940168 12:13400812-13400834 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1093186604 12:16027370-16027392 ATTCACAGGTTCCAGGGATTAGG - Intronic
1093950071 12:25155617-25155639 CCTCACAGATCCCAGGTTTTAGG - Intronic
1094043354 12:26141052-26141074 ATTCACAGGTTCCAGGGATTAGG - Intronic
1095309821 12:40685370-40685392 ACTCACAGATTCCAGGGATTAGG + Intergenic
1096055821 12:48651107-48651129 ATTCACAGATCCCAGGGATTAGG + Intergenic
1096626393 12:52898624-52898646 CACCCCAGGTCCCAGGGATAGGG + Intronic
1096678333 12:53238413-53238435 CCTCCCAGGTTCAAGTGATTCGG + Intergenic
1096853967 12:54465145-54465167 CTTCTCAGGGTCCAGGGAGTCGG + Exonic
1097374930 12:58830905-58830927 ATTCACAGGTTCCAGGGATTAGG + Intergenic
1097483041 12:60155727-60155749 CTTCCCAGGTTCCAGGGATGAGG - Intergenic
1098040867 12:66353019-66353041 CCTACAAGGCCCCAGGGATTTGG - Intronic
1099518037 12:83623397-83623419 ATTCACAGGTTCCAGGGATTTGG - Intergenic
1100019481 12:90051793-90051815 TCTCACAGATTCCAGGGATTTGG - Intergenic
1100374100 12:93996390-93996412 CCTTTTAGACCCCAGGGATTTGG - Intergenic
1100892021 12:99136200-99136222 CCTCTCAGGACCCAGGTATGGGG + Intronic
1101191278 12:102336023-102336045 ATTCACAGGTTCCAGGGATTTGG - Intergenic
1101437505 12:104676822-104676844 ATTCACAGGTTCCAGGGATTAGG + Intronic
1101748122 12:107559472-107559494 CCCCTCTGCTCCCAGGCATTTGG - Intronic
1101964950 12:109276120-109276142 ATTCGCAGGTTCCAGGGATTAGG + Intergenic
1102495475 12:113316287-113316309 ACTCCCAGGTTCCAGGGGTTAGG + Intronic
1102696985 12:114807747-114807769 CCTCACAGGTTCCAGGGATTAGG - Intergenic
1103027690 12:117587175-117587197 ACTCCCAGGTTCCAGGGATCAGG - Intronic
1103341036 12:120221326-120221348 CCTCTCAGGTCGAGGGGATCAGG - Intronic
1103970834 12:124670435-124670457 ATTCACAGGTCCCAGGGCTTAGG + Intergenic
1104920745 12:132289468-132289490 ACTCACCGGTTCCAGGGATTAGG - Intronic
1107082632 13:36391148-36391170 CCTTACAGGTACCAGGGATTAGG + Intergenic
1107418392 13:40222490-40222512 ATTCACAGGTTCCAGGGATTAGG + Intergenic
1107638448 13:42416733-42416755 ATTCTCAGGTTCCAAGGATTAGG - Intergenic
1107702921 13:43066561-43066583 ATTCTCAGGTTCCAAGGATTAGG + Intronic
1108884812 13:55166413-55166435 TCTCTCAGATTCCATGGATTAGG - Intergenic
1109192230 13:59339140-59339162 CCTTTGAGGTGCCAGGCATTGGG - Intergenic
1109507271 13:63320061-63320083 ACTCACAGGCTCCAGGGATTAGG + Intergenic
1110605324 13:77425618-77425640 ACTCACAGATCCCAGTGATTAGG - Intergenic
1110629974 13:77697496-77697518 CCAATCAGGCCCCTGGGATTAGG + Intergenic
1111929981 13:94503032-94503054 ATTCACAGGTCCCAGGGCTTAGG - Intergenic
1112191782 13:97185406-97185428 ATTCTCAGGTTCCAGGAATTGGG - Intergenic
1112300627 13:98226446-98226468 ACTCACAGGTACCAGGGATTAGG + Intronic
1112487219 13:99830838-99830860 ATTCACAGGTCCCAGGGATTAGG - Intronic
1113367813 13:109693167-109693189 CTTCACAGGTACCAGGGGTTAGG - Intergenic
1113607706 13:111622251-111622273 CCCCGCAGGTCCCAGGGGCTGGG - Intronic
1114446075 14:22789270-22789292 GCTCACAGGTTCCAGGGATTAGG - Intronic
1114532778 14:23405847-23405869 CCTCCCAGGACACAGGGACTTGG + Intronic
1114705094 14:24717088-24717110 GTTCCCAGGTCCCAGAGATTAGG - Intergenic
1114713052 14:24797668-24797690 ATTCACAGGTTCCAGGGATTAGG + Intergenic
1114717001 14:24837570-24837592 ACTCTCAGGTCCCAGGACTTTGG + Intronic
1114756667 14:25267804-25267826 CCTTACAGGCCACAGGGATTAGG - Intergenic
1114763836 14:25348314-25348336 ATTCACAGGGCCCAGGGATTAGG + Intergenic
1115886904 14:37982178-37982200 ATTCACAGGTCCCAGGAATTAGG - Intronic
1116110219 14:40569737-40569759 ATTCACAGGTCCTAGGGATTAGG - Intergenic
1117581789 14:57158539-57158561 ATTCACAGGTGCCAGGGATTTGG - Intergenic
1117656993 14:57965491-57965513 ACCCACAGGTTCCAGGGATTTGG + Intronic
1117772815 14:59151767-59151789 CTTCTGAGGTCCTGGGGATTAGG + Intergenic
1117795861 14:59393899-59393921 ATTCACAGGTCCCAGGGATTAGG + Intergenic
1118270900 14:64341185-64341207 ACTCATAGGTTCCAGGGATTAGG - Intergenic
1118576315 14:67244802-67244824 ATTCACAGGTTCCAGGGATTAGG - Intronic
1118877558 14:69797771-69797793 CCTCTCAGCTCCCAGGAAAAGGG - Intergenic
1119867726 14:77988066-77988088 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1120272341 14:82329303-82329325 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1120675137 14:87413201-87413223 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1120761556 14:88290064-88290086 GCTCACAGGTTCCAGGGATCAGG - Intronic
1120836502 14:89042526-89042548 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1121468721 14:94135099-94135121 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1121572139 14:94954443-94954465 ACTCACAGGTTCCAGGGATTAGG + Intergenic
1121712689 14:96051351-96051373 CTTCCTAGGACCCAGGGATTTGG - Intronic
1122010015 14:98738583-98738605 CTTCACAGGTACCAGGGGTTAGG + Intergenic
1122901665 14:104784607-104784629 CCTCTCAGAACCCCGGTATTTGG - Intronic
1123707462 15:22960308-22960330 CCTCACAGGTCCCACGCAGTGGG + Intronic
1125069118 15:35530963-35530985 CCTTTCAGTTCCCAGGATTTTGG - Intronic
1125267668 15:37901690-37901712 ACTCTGAGGTACTAGGGATTAGG + Intergenic
1125477295 15:40055737-40055759 CCTCACAGGGCCCAGGGCTCTGG + Intergenic
1125610358 15:40965290-40965312 CCTCTCAGATTCTTGGGATTAGG + Intergenic
1126097649 15:45100721-45100743 TCTCTTTGGGCCCAGGGATTTGG + Intronic
1126344132 15:47675258-47675280 ATTCTGAGGTCCTAGGGATTAGG - Intronic
1126401307 15:48273476-48273498 ACTCACAGGTTCCAGGAATTAGG + Intronic
1126662907 15:51049586-51049608 CATCAGAGGTCCCAGGGATGGGG - Intergenic
1127633521 15:60848245-60848267 ATTCACAGGTTCCAGGGATTAGG - Intronic
1128215431 15:65931044-65931066 ATTCACAGATCCCAGGGATTAGG - Intronic
1129140525 15:73593931-73593953 CTTCTTAAGGCCCAGGGATTTGG - Intronic
1129615269 15:77094268-77094290 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1130015416 15:80182311-80182333 ATTCACAGGTCCTAGGGATTTGG + Intronic
1130341217 15:83000736-83000758 CCTCCTAGATTCCAGGGATTTGG - Intronic
1130397402 15:83514880-83514902 ACTCACAGGTCCTAGGGATTAGG - Intronic
1131668955 15:94599207-94599229 CCCCTCAGTTACCAGGTATTTGG + Intergenic
1132295372 15:100730607-100730629 CCACTCAGCTCCCACTGATTGGG - Intergenic
1133368981 16:5233833-5233855 CCTCTGTGGTCCCAGGTACTTGG + Intergenic
1133527670 16:6621588-6621610 ATTCTCAGGTACCAGGGACTAGG + Intronic
1133790559 16:9006478-9006500 ATTCACAGGTCCCAGGGATTAGG - Intergenic
1133904820 16:10012575-10012597 ATTCACAGGTTCCAGGGATTAGG - Intronic
1133912247 16:10076870-10076892 GCTCACAGGTTCCAGGAATTAGG - Intronic
1134042745 16:11080928-11080950 GTTCACAGGTTCCAGGGATTAGG + Intronic
1134085987 16:11357826-11357848 CATCTCAGGTCCCTTGGATCAGG - Intergenic
1135408268 16:22213959-22213981 ATTCACAGGTTCCAGGGATTAGG + Intronic
1136012128 16:27370648-27370670 GTTCACAGGTTCCAGGGATTGGG - Intergenic
1136292929 16:29286724-29286746 ATTCACAGGTCCCAGGGATTAGG - Intergenic
1137392304 16:48091836-48091858 ATTCGCAGGTTCCAGGGATTAGG - Intronic
1137737369 16:50734973-50734995 ATTCCCAGGTCCCGGGGATTAGG - Intergenic
1137932930 16:52605687-52605709 AGTCACAGGTACCAGGGATTAGG - Intergenic
1138332111 16:56223535-56223557 CCTGTAAAGTTCCAGGGATTAGG + Intronic
1138847849 16:60588634-60588656 TCTCTCAGCTGCCAAGGATTGGG - Intergenic
1139309489 16:66016397-66016419 ATTCACAGGTCCCAGGGGTTAGG + Intergenic
1139922600 16:70469334-70469356 CCTCTCAGCTCCCTGGGGTGGGG + Intronic
1140097122 16:71884329-71884351 CCTCTCGGGCGCCCGGGATTGGG - Intronic
1140396823 16:74634508-74634530 CCTCTCTGGTCCCAGCTACTTGG - Intronic
1140963799 16:79944214-79944236 CCTCGCAGGTCCCAGGGGGATGG + Intergenic
1140986868 16:80166187-80166209 ACTCACAGGTTCCAGGAATTAGG - Intergenic
1141041143 16:80673724-80673746 ATTCATAGGTCCCAGGGATTAGG - Intronic
1141244602 16:82294197-82294219 ACTCACTGGTTCCAGGGATTTGG - Intergenic
1141478270 16:84288457-84288479 GCTCGCAGGTCCTGGGGATTAGG + Intergenic
1141790814 16:86232811-86232833 CCTCTTGGCTCCCAGGCATTGGG + Intergenic
1141804229 16:86332187-86332209 AATCCCAGGTTCCAGGGATTAGG + Intergenic
1141839518 16:86565884-86565906 CCTCGCAGGGCCCAGGAACTCGG + Intergenic
1142098815 16:88260729-88260751 ATTCACAGGTCCCAGGGATTAGG - Intergenic
1142358964 16:89617308-89617330 CCTCTCAGGGCCCTGGGCCTTGG - Intronic
1142359801 16:89620683-89620705 CCTCCCAGGTCACAAGGCTTGGG - Exonic
1143066583 17:4253896-4253918 ATTCCCAGGTTCCAGGGATTAGG - Intronic
1143907830 17:10223690-10223712 ATTCTCAGGCTCCAGGGATTGGG + Intergenic
1143963276 17:10738198-10738220 ATTCACAGGTCCCAGGGGTTAGG + Intergenic
1144688876 17:17245977-17245999 CCTCTCCTGTCACAGGAATTTGG - Intergenic
1145112590 17:20176877-20176899 ACTCACAGGTTCTAGGGATTAGG + Intronic
1145734138 17:27214569-27214591 CCTCTCCAGTCCCAGGGAGTTGG + Intergenic
1145876347 17:28321005-28321027 AGTCACAGGTTCCAGGGATTAGG + Intronic
1146390260 17:32415641-32415663 CCTGTCAGATCCCATTGATTGGG - Intergenic
1146404898 17:32528548-32528570 ATTCACAGGTTCCAGGGATTAGG - Intronic
1146673493 17:34757721-34757743 CCTCCCAGGTCCCAGGAAACAGG + Intergenic
1147322139 17:39652986-39653008 CCTCCCAGTTGCCATGGATTAGG + Intronic
1148130821 17:45261863-45261885 CCTTTCAGGTGCCGGGGGTTTGG + Intronic
1148223434 17:45881477-45881499 ATTCACAGGTCCCAGGGACTTGG + Intergenic
1148963273 17:51411370-51411392 CTTCACAGGTACCAGGGATTAGG - Intergenic
1149018490 17:51936121-51936143 CCTCTGATGTGCCAGGCATTAGG + Intronic
1149124019 17:53206211-53206233 CCCCACAGAGCCCAGGGATTAGG + Intergenic
1149911956 17:60574861-60574883 ATTCACAGGTTCCAGGGATTAGG - Intronic
1149991600 17:61386634-61386656 CCTCTCAGGTCCCTGAGACTAGG + Intronic
1150375565 17:64678740-64678762 ATTCACAGGTACCAGGGATTAGG - Intergenic
1150655239 17:67034861-67034883 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1150732401 17:67707119-67707141 CCTCTCAAGTAGCTGGGATTAGG - Intergenic
1150905530 17:69332794-69332816 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1151005829 17:70435033-70435055 ACTCACAGGTTTCAGGGATTAGG + Intergenic
1151343826 17:73489322-73489344 CCCTTAAGGTCCCTGGGATTTGG - Intronic
1151805332 17:76401315-76401337 CCTCTGCGGACCCAGGGTTTGGG - Intronic
1151917302 17:77127715-77127737 CTTCACAGGTACCAGGGGTTAGG - Intronic
1151993079 17:77591135-77591157 CCTCTCAGCGCCCAGGGCATGGG - Intergenic
1152799466 17:82324130-82324152 CCTCTCAGAGCACAGGTATTTGG + Intronic
1152886709 17:82855806-82855828 CCTGGCAGGTGCCAGGGGTTGGG - Intronic
1153784370 18:8521409-8521431 ACTCATAGGTTCCAGGGATTAGG - Intergenic
1153961713 18:10145678-10145700 GGTCTCAGGCCCCAGGGCTTGGG - Intergenic
1154157075 18:11952021-11952043 CCTCTCAGCTTCCTTGGATTTGG - Intergenic
1155333761 18:24744486-24744508 CCTCTCAAGTCACAGGCATCTGG + Intergenic
1155364837 18:25039501-25039523 ATTCACAGGTTCCAGGGATTAGG + Intergenic
1155571773 18:27202432-27202454 CCTCACAGGTCTAAGGGATTTGG + Intergenic
1155778324 18:29795964-29795986 ATTCACAGGTTCCAGGGATTAGG + Intergenic
1156255515 18:35392160-35392182 GTTCACAGGTTCCAGGGATTGGG - Intergenic
1156259365 18:35430381-35430403 AGTCACAGGTACCAGGGATTAGG + Intergenic
1157101994 18:44739263-44739285 ATTCACAGGTTCCAGGGATTAGG + Intronic
1157327983 18:46682617-46682639 AGTCACAGGTTCCAGGGATTAGG - Intronic
1157897904 18:51486067-51486089 CCTCTCAAGTTCCAGGCATTAGG - Intergenic
1157898699 18:51492823-51492845 ACTCATAGGTTCCAGGGATTAGG + Intergenic
1158172941 18:54619783-54619805 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1159431371 18:68357314-68357336 CTTCTGAGGTCACTGGGATTTGG + Intergenic
1159840692 18:73395156-73395178 ATTTTCAGGTTCCAGGGATTTGG + Intergenic
1160019574 18:75170089-75170111 CTTCACAGGTCTCAGGGGTTAGG - Intergenic
1160111242 18:76033836-76033858 CTTCTTAGGTACCAGGGATTAGG - Intergenic
1160149703 18:76389819-76389841 CCCCTCAGGTCCCAGGGTTGCGG - Intronic
1160534370 18:79584383-79584405 ACTCTCAGGTCTCAGGGGCTGGG + Intergenic
1160588281 18:79925180-79925202 CCTCCCAGGTCCCTCGGAATAGG - Intronic
1160984481 19:1831970-1831992 GGCCACAGGTCCCAGGGATTAGG - Intronic
1161066782 19:2242548-2242570 GTTCACAGGTCCCAGGGATTAGG + Intronic
1161650590 19:5481998-5482020 TCTCACAGTTCCCATGGATTGGG + Intergenic
1161666916 19:5582708-5582730 GTTCATAGGTCCCAGGGATTAGG - Intergenic
1161845797 19:6711249-6711271 ATTCCCAGGTCTCAGGGATTCGG - Intronic
1161874090 19:6894179-6894201 ATTCACAGGTTCCAGGGATTAGG + Intronic
1162356478 19:10188573-10188595 ATTCACAGGTTCCAGGGATTAGG - Intronic
1163241524 19:16066856-16066878 CCTCTCTAGTATCAGGGATTAGG - Intergenic
1163688296 19:18724815-18724837 ACTCTCAGGTTCCAGGGATGAGG + Intronic
1164551482 19:29216210-29216232 ATTCCCAGGTTCCAGGGATTAGG - Intergenic
1164772376 19:30819479-30819501 CTTCTCAGGTCCCAGGGAGATGG + Intergenic
1164800473 19:31071900-31071922 CATCTCAGGTTCATGGGATTTGG - Intergenic
1166219947 19:41357823-41357845 CCTCTGAGGTCCCTGGGGCTGGG - Intronic
1166398370 19:42459344-42459366 ATGCACAGGTCCCAGGGATTAGG - Intergenic
1166685435 19:44793649-44793671 CCACTCAGGCCTCAGGAATTTGG - Intronic
1166695846 19:44851135-44851157 ACTCCCAGGTCTGAGGGATTAGG - Intronic
1166888494 19:45975401-45975423 GCTCTCAGGTCCCCAGGATGGGG + Intergenic
1167563182 19:50238806-50238828 ATTCACAGGTCCCAGGGATTAGG + Intronic
925326464 2:3025877-3025899 CTTCACAGGTACCAGGGGTTAGG - Intergenic
925516194 2:4684899-4684921 ATTCACAGATCCCAGGGATTAGG - Intergenic
925994905 2:9284162-9284184 ACTCACAAGTTCCAGGGATTAGG + Intronic
926124758 2:10265288-10265310 ACTCCCAGGTTCCAGGGATTAGG + Intergenic
926134825 2:10329244-10329266 ATCCGCAGGTCCCAGGGATTCGG - Intronic
926417173 2:12661251-12661273 GCTCTCAGATTCCAGGGATTAGG - Intergenic
926613802 2:14974763-14974785 ATTCACAGGTTCCAGGGATTAGG - Intergenic
927147893 2:20178902-20178924 GCTCTCTGGGCCCAGGGACTGGG + Intergenic
927190504 2:20513826-20513848 TGTCACAGGTACCAGGGATTAGG - Intergenic
927231997 2:20833484-20833506 CATCACAGGTTCCAGGGATTAGG - Intergenic
927362121 2:22248328-22248350 ATTCACAGGTCCCAGAGATTAGG - Intergenic
927676710 2:25111547-25111569 ATTCACAGGTTCCAGGGATTAGG - Intronic
927812713 2:26188846-26188868 CCTCTGAGGTGCCATGGGTTAGG - Exonic
927893593 2:26767509-26767531 CCTGCCAGGACCCAGGGATGGGG - Intronic
927971217 2:27307218-27307240 CCTCTGAGGTCCTGGGGATTTGG + Exonic
928116515 2:28548924-28548946 CCTCTCAGGTAGGAGGGACTGGG + Exonic
928360891 2:30661557-30661579 TCTACCAGGTCCCTGGGATTGGG - Intergenic
928395131 2:30937793-30937815 CCTGACAGGTTCCAGGGATTAGG + Intronic
928439662 2:31281780-31281802 CCCCTCAGGGCCCAGGTCTTAGG - Intergenic
929049834 2:37826650-37826672 ATTCACAGGTTCCAGGGATTAGG + Intergenic
929943714 2:46354478-46354500 CCTCTTAGGCCCCAGGCCTTTGG - Intronic
931275905 2:60743757-60743779 CCTGTCAGATCCCAGGGCCTGGG + Intergenic
931485411 2:62685613-62685635 ACTCTGAGGTACTAGGGATTAGG + Intronic
931603970 2:64033100-64033122 TATCACATGTCCCAGGGATTTGG + Intergenic
931685322 2:64787354-64787376 CATGACAGGTTCCAGGGATTTGG - Intergenic
931807525 2:65822161-65822183 ATTCACAGGTTCCAGGGATTAGG - Intergenic
932147300 2:69333836-69333858 CATCACTGGGCCCAGGGATTAGG + Intronic
932592245 2:73074501-73074523 TCTCTCAGGGCCCTGGGAATGGG - Exonic
935586527 2:104804598-104804620 ATTCACAGGTTCCAGGGATTAGG + Intergenic
936176139 2:110221623-110221645 CCTCTCAGCTTCCTGGGCTTTGG + Intergenic
937013734 2:118584566-118584588 GCTTTCAGTTCCCAGGGATCAGG - Intergenic
937302833 2:120853740-120853762 CCTCGCAGGCCCCAGGGGTCAGG + Intronic
937349991 2:121154684-121154706 CCTCTGAGGTCCCAGAGAGAGGG - Intergenic
937426747 2:121806333-121806355 ACTCACAGGTTCCAGGGATTAGG - Intergenic
937570986 2:123361083-123361105 ATTCACAGGTTCCAGGGATTAGG + Intergenic
937615220 2:123913839-123913861 GCTCTCATGTCCCAGGCATTGGG - Intergenic
938310749 2:130286838-130286860 CCCCTCAGGGCCCAGTGGTTTGG + Intergenic
938449995 2:131409598-131409620 CCTCTCTGGAACCAGGGATAAGG - Intergenic
938694119 2:133819799-133819821 CCTTTCAGGTGCAAGGGAATGGG + Intergenic
939892766 2:147757346-147757368 ATTCACAGGTCTCAGGGATTTGG - Intergenic
939958596 2:148546893-148546915 ACTTTGAGGTACCAGGGATTAGG - Intergenic
940174354 2:150862498-150862520 ACTCTCAGGTCCCAGAGAAGGGG + Intergenic
940651928 2:156449179-156449201 ATTCACAGGTTCCAGGGATTAGG + Intronic
941167963 2:162103887-162103909 CTTCTCAGGTGCCATGGCTTTGG + Intergenic
943070458 2:183135193-183135215 ATTCACAGGTTCCAGGGATTAGG + Intronic
943538730 2:189184772-189184794 ACTCACAGGTTCTAGGGATTAGG + Intergenic
944064660 2:195606130-195606152 CCTCTCAGGTCCAGGGGCTGTGG - Intronic
944662720 2:201934529-201934551 ACTCACACGTTCCAGGGATTAGG - Intergenic
944681948 2:202085255-202085277 CCTCTCAGGTCCCAGGGATTAGG - Intronic
945217146 2:207445708-207445730 ACTCACAGGTTCCAGGGATGAGG + Intergenic
945441732 2:209887543-209887565 ATTCACAGGTCCCAGGGATTAGG + Intronic
945753545 2:213818324-213818346 CCTCTGAGGTCCCAGGGAGGTGG - Intronic
946134662 2:217635977-217635999 AGTCACAGGTTCCAGGGATTAGG + Intronic
946415149 2:219536529-219536551 CCTCTGAGGGCCCTGGGTTTGGG + Intronic
946421879 2:219570055-219570077 CCTCTCACTCCCCAGGGATTCGG - Intronic
946585655 2:221184701-221184723 GCTCATAGGTTCCAGGGATTAGG - Intergenic
946931413 2:224675256-224675278 GCTCTTAGGTCCCAGGAAATAGG + Intergenic
947504951 2:230701022-230701044 ATTCACAGGTTCCAGGGATTAGG + Intergenic
947965843 2:234280875-234280897 CCTCACAGTTCCTATGGATTGGG - Intergenic
948267242 2:236643891-236643913 ATTCACAGGTCCCAGGGACTAGG - Intergenic
948335533 2:237204119-237204141 ATTCACAGGTTCCAGGGATTAGG + Intergenic
948435209 2:237948642-237948664 ATTCACAGGTTCCAGGGATTAGG + Intergenic
948843248 2:240669896-240669918 CTTCACAGGTACCAGGGTTTAGG - Intergenic
948961297 2:241340283-241340305 TCTCTCAGGTTGCAGGGACTTGG + Intronic
1169416808 20:5424161-5424183 ACTCACAGGTTCCAGGGACTGGG + Intergenic
1169447898 20:5687753-5687775 ATTCACAGGTCCCAGGGGTTGGG + Intergenic
1169452997 20:5728254-5728276 ATTCACAGGTCCCAGGGATTAGG - Intergenic
1169756209 20:9046034-9046056 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1170063471 20:12285276-12285298 ACTCACAGGTCCCAGCAATTAGG + Intergenic
1170119345 20:12894884-12894906 AGTCACAGGTTCCAGGGATTAGG - Intergenic
1170773682 20:19356982-19357004 ATTCACAGGTTCCAGGGATTAGG - Intronic
1170968345 20:21096292-21096314 CATCTCAGGACCCAGCCATTGGG + Intergenic
1171229953 20:23476107-23476129 CCTCCCAGGGTCCAGGGATGGGG - Intergenic
1171403221 20:24892694-24892716 CTGCTCAGGCCCCAGGGAGTGGG - Intergenic
1173010587 20:39178178-39178200 ACTCACAGGTTCTAGGGATTAGG - Intergenic
1173013619 20:39205021-39205043 CCTCAGAGGTCCCGAGGATTAGG + Intergenic
1173051333 20:39564807-39564829 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1173291566 20:41719510-41719532 AATCACAGGTTCCAGGGATTAGG + Intergenic
1173327235 20:42045172-42045194 ATTCACAGGTTCCAGGGATTAGG + Intergenic
1173378074 20:42507808-42507830 CCGGTCAGGTCCCAGGGATCAGG + Intronic
1173488056 20:43456158-43456180 CTTCACAGGTTTCAGGGATTAGG + Intergenic
1173498326 20:43534738-43534760 TCTGACAGGTCCCAGGGATGGGG + Intronic
1174384352 20:50178270-50178292 ATTCACAGGTCCCAGGGGTTAGG - Intergenic
1174417819 20:50379202-50379224 CCCCTCAGGACCCAGGGAGCTGG - Intergenic
1174518841 20:51114226-51114248 TTTGACAGGTCCCAGGGATTAGG + Intergenic
1174898103 20:54471984-54472006 CCTCTCATTTCCCAGGAAGTGGG - Intergenic
1174952188 20:55054367-55054389 ATTCACAGGTCCCAGAGATTAGG + Intergenic
1175231161 20:57474266-57474288 CATCACAGGTTGCAGGGATTAGG - Intergenic
1177126532 21:17200700-17200722 ATTTTCAGGTTCCAGGGATTAGG + Intergenic
1177713070 21:24805143-24805165 GCTCACAGGTTCCAGGCATTAGG + Intergenic
1178357128 21:31918822-31918844 ATTTTCAGGTTCCAGGGATTAGG + Intronic
1178623184 21:34194068-34194090 CCTCTCATCTCCCAGGCCTTTGG + Intergenic
1178738796 21:35177252-35177274 TTTCACAGGTTCCAGGGATTAGG + Intronic
1178791982 21:35708937-35708959 CCTCTCAGCTACCTGGGATTTGG - Intronic
1179165406 21:38931762-38931784 ATTCCCAGGTACCAGGGATTGGG - Intergenic
1179176717 21:39013304-39013326 GCTCTCAGGCCACAGGGAATGGG - Intergenic
1179596803 21:42448439-42448461 ATTCCCAGGTCCCGGGGATTAGG + Intergenic
1179952314 21:44715634-44715656 CCTCTCTGGTCCCAGCTACTTGG - Intergenic
1179971022 21:44836595-44836617 CCACTGAGGTCCCAGGGGTTTGG - Intergenic
1180146381 21:45922108-45922130 GCTCTCAGGTCCCAGGTCTCAGG - Intronic
1180183829 21:46129840-46129862 CCTCACAGGCTCCAGGGTTTGGG + Intronic
1180939682 22:19650817-19650839 CTTCATAGGTTCCAGGGATTAGG - Intergenic
1181082767 22:20425498-20425520 CTTCTCAGGCCCCGGGGTTTCGG + Exonic
1181532538 22:23525058-23525080 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1181812312 22:25411115-25411137 ATTCACAGGTCCCAGGGATTAGG - Intergenic
1182004109 22:26944775-26944797 ATTCACAGGTTCCAGGGATTAGG + Intergenic
1182437902 22:30342306-30342328 CCTCTCACGTTCCTGGAATTTGG + Exonic
1183157442 22:36086160-36086182 CCTCTCAGATCCCAGGGTGATGG + Intergenic
1183334516 22:37239020-37239042 AATCTCAGGTGCCAGAGATTTGG + Intronic
1183606430 22:38869077-38869099 CAGCCCAGCTCCCAGGGATTGGG + Intronic
1184124204 22:42475525-42475547 ATTCACAGGTACCAGGGATTAGG - Intergenic
1184413154 22:44337409-44337431 ACTGGCAGGTTCCAGGGATTAGG + Intergenic
1184483929 22:44765106-44765128 ACTCTCAGGTCACAGGGCTGAGG - Intronic
1184714398 22:46272790-46272812 CCTCTCATGTTCCAGGGGTCTGG - Intronic
949182455 3:1150731-1150753 ACTCACAGGTTCCAGGTATTAGG - Intronic
949212959 3:1527485-1527507 TCTCTCAGGTCCTAGGTCTTAGG + Intergenic
949938977 3:9139265-9139287 ATTCCCAGGTTCCAGGGATTAGG - Intronic
949984188 3:9526603-9526625 ATTCACAGGTACCAGGGATTAGG - Intronic
950094647 3:10321874-10321896 CCTCTCAGTACCCAAGGACTGGG + Intergenic
951330378 3:21360691-21360713 ATTCTCAAGTTCCAGGGATTAGG + Intergenic
951394836 3:22152778-22152800 ATTCACAGGTCTCAGGGATTAGG + Intronic
951605754 3:24433217-24433239 ATTCACAGGTTCCAGGGATTAGG - Intronic
951892533 3:27580620-27580642 ACTCTCAGGTACCGGGGGTTAGG + Intergenic
952816012 3:37448786-37448808 ATTCACAGGTTCCAGGGATTAGG + Intergenic
953285159 3:41599418-41599440 ACTCACAGGTTTCAGGGATTAGG + Intronic
953450320 3:43000070-43000092 GGTCCCAGGTCCCAGAGATTAGG + Intronic
954285285 3:49614874-49614896 CCACTCAGGCCCCAGGGCTGGGG + Intronic
954757232 3:52847696-52847718 ACTCACAGGTTCCAGGGATTTGG - Intronic
955486483 3:59439400-59439422 CGTCCTAGGTCCCAGGGTTTAGG - Intergenic
955741240 3:62093653-62093675 CAACTCAGGTACAAGGGATTAGG + Intronic
956515860 3:70047050-70047072 ACTCACAGGTTCCAGGGATTTGG + Intergenic
956715584 3:72076947-72076969 ATTCACAGGTTCCAGGGATTAGG + Intergenic
958736168 3:98011641-98011663 CTTCACAGGTTCCAGGAATTAGG + Intronic
959096095 3:101957844-101957866 AGTCACAGGTTCCAGGGATTAGG - Intergenic
960438421 3:117656242-117656264 CCAATCAGGTATCAGGGATTCGG - Intergenic
960880083 3:122335256-122335278 AGTCACAGGTTCCAGGGATTAGG - Intronic
961170637 3:124795549-124795571 AGTCACAGGTTCCAGGGATTAGG - Intronic
961180763 3:124875353-124875375 CCTCTCAAGTAGCTGGGATTAGG - Intronic
961322965 3:126090964-126090986 CCTCTCAGGTCCTAGGCAGCTGG - Intronic
961427349 3:126858545-126858567 CCTGTAAGGTCCCTGGGATTTGG - Intronic
961517548 3:127447407-127447429 ATTCTCAGGTTCCAGGGATTAGG - Intergenic
963348731 3:144127078-144127100 CTTTTCAGGTTCCAGGGATTAGG + Intergenic
963764087 3:149315765-149315787 ATTCACAGGTCCCATGGATTAGG + Intergenic
965188593 3:165499628-165499650 CATCACAGGTTCTAGGGATTAGG - Intergenic
965635804 3:170779073-170779095 CCTCTCTGGTACCAGAGAGTGGG + Intronic
965674438 3:171179954-171179976 ACTCTCAGTTCCTAGGGATTTGG - Intronic
966323417 3:178727409-178727431 CTTCTCAGGTTCTAGAGATTAGG - Intronic
966887771 3:184386332-184386354 CATCTCAGCTGCCAGGGATAGGG - Intronic
968260643 3:197321010-197321032 TGTCTCAGGTTCCAGGGAGTTGG + Intergenic
968654039 4:1771044-1771066 CCTCTCAGGTCCCAGGGTCAGGG - Intergenic
969222668 4:5771513-5771535 GCTCAAAGGTTCCAGGGATTGGG + Intronic
969359845 4:6656621-6656643 AATCACAGGTTCCAGGGATTAGG + Intergenic
969418167 4:7074580-7074602 ATTCACAGGTGCCAGGGATTAGG + Intergenic
970243030 4:14029256-14029278 CCTCTCAGGTAGCATGGGTTGGG - Intergenic
970273009 4:14367498-14367520 ATTCACAGGTTCCAGGGATTAGG + Intergenic
970558579 4:17260272-17260294 CATCTCAGTTTCCAGGGATCAGG + Intergenic
972419847 4:38877064-38877086 ACTCACAGGTTCCAGGAATTGGG + Intronic
972624758 4:40785936-40785958 CCTCCCTGGTGCCAGGGAATAGG + Intronic
972842541 4:42948637-42948659 ATTCACAGGTTCCAGGGATTAGG - Intronic
972843195 4:42955761-42955783 CCTCTAAGTTCTCAGTGATTTGG + Intronic
975252170 4:72193133-72193155 CCTCTCAGGCCCCATGGCTCTGG + Intergenic
976010560 4:80482965-80482987 AATCACAGGTTCCAGGGATTAGG - Intronic
976126089 4:81835176-81835198 ATTCACAGGTACCAGGGATTAGG - Intronic
976642583 4:87354516-87354538 CCTGTATGGTCCCAGGGACTGGG + Intronic
977366483 4:96075342-96075364 ATTCACAGGTCCCAGGGATTAGG + Intergenic
977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG + Intronic
977929458 4:102735217-102735239 TCTATCAGGTGCAAGGGATTTGG + Intronic
978426148 4:108584599-108584621 ATTCACAGGTTCCAGGGATTAGG + Intergenic
979208061 4:118065108-118065130 ATTCACAGGTTCCAGGGATTAGG + Intronic
979289070 4:118959873-118959895 ACTCACAGGTTCCAGGAATTAGG - Intronic
979604475 4:122623205-122623227 TTTCACAGGTTCCAGGGATTAGG - Intergenic
979845869 4:125510847-125510869 ACTCACAGGTCCTTGGGATTTGG + Intergenic
980263196 4:130481278-130481300 ATTCACAGGTTCCAGGGATTAGG - Intergenic
980975267 4:139604977-139604999 AGTCACAGGTTCCAGGGATTAGG + Intronic
981452472 4:144914269-144914291 ATTCACAGGTTCCAGGGATTAGG + Intergenic
981518620 4:145636914-145636936 ATTCACAGGTTCCAGGGATTAGG - Intronic
981634844 4:146864886-146864908 ATTCACAGGTTCCAGGGATTAGG + Intronic
981709696 4:147696939-147696961 CATCTCTGGTACCAGGAATTTGG - Intergenic
981759013 4:148173246-148173268 ATTCACAGATCCCAGGGATTGGG - Intronic
982222659 4:153138158-153138180 CTTCTCAGGTTCCAGGGGTCGGG + Intergenic
982673627 4:158350636-158350658 ATTCTAAGGTTCCAGGGATTGGG + Intronic
982832712 4:160084556-160084578 CTTCTCACTTCCCAGGGACTGGG + Intergenic
983705431 4:170652921-170652943 ATTCACAGGTTCCAGGGATTAGG - Intergenic
984465071 4:180088967-180088989 ACTAACAGGCCCCAGGGATTTGG + Intergenic
985234206 4:187855283-187855305 ATTCACAGGTTCCAGGGATTAGG - Intergenic
986216793 5:5726926-5726948 ATTCCCAGGTTCCAGGGATTAGG - Intergenic
986367537 5:7048166-7048188 CCTCTCAGGGGCCAGAGAGTTGG - Intergenic
986620252 5:9665416-9665438 CATCTCAGTTCCCAGTGATTGGG + Intronic
986849682 5:11796249-11796271 GTTCACAGGTTCCAGGGATTAGG + Intronic
986962894 5:13237091-13237113 ATTCACAGGTTCCAGGGATTAGG + Intergenic
986987166 5:13513147-13513169 AGTCACAGGTCCCAGGGATTAGG - Intergenic
988133887 5:27143216-27143238 ACTCACAGATTCCAGGGATTAGG - Intergenic
991082427 5:62615546-62615568 ATTCACAGGTTCCAGGGATTAGG - Intronic
991214344 5:64144934-64144956 TCTCTGAGGTCCCAGTGTTTTGG - Intergenic
992083855 5:73260323-73260345 TCTCTGAGGTTCCAGGGATTAGG - Intergenic
992659677 5:78945891-78945913 CCTCTCAGAGCCCAGGGTGTGGG - Intronic
993154954 5:84211027-84211049 ATTCACAGGTTCCAGGGATTTGG - Intronic
994840438 5:104917746-104917768 CCCCTCAGGTCCTTGGCATTTGG + Intergenic
995261959 5:110114473-110114495 ATTCACAGGTTCCAGGGATTAGG + Intergenic
995324076 5:110872192-110872214 CCTCGCAGGTCACAGAGAGTCGG - Intergenic
995729535 5:115223270-115223292 ATTCACAGGTTCCAGGGATTAGG - Intronic
995736064 5:115300194-115300216 ATTCACAGGTACCAGGGATTAGG + Intergenic
996175053 5:120346205-120346227 CCTTTCAGGTGCCAGTGACTTGG - Intergenic
996418221 5:123233187-123233209 ATTCACAGGTTCCAGGGATTAGG - Intergenic
996722230 5:126641168-126641190 CCTCTCAGCTTCCCTGGATTAGG + Intergenic
997205468 5:132046188-132046210 TATCACAGGTTCCAGGGATTAGG + Intergenic
997384141 5:133459167-133459189 CCTCTCAGGCCCAAGGAAATGGG - Intronic
997605630 5:135173911-135173933 ACTGTCAGTTCCTAGGGATTAGG + Intronic
998175789 5:139901196-139901218 CATCCCAGGTCCCAGGCATTTGG - Intronic
998788029 5:145733803-145733825 GCTCACAGGTTCCAAGGATTAGG - Intronic
998807914 5:145936862-145936884 CCTCACAAGTGCCAGGGCTTCGG - Intronic
999615716 5:153420977-153420999 ATTCTCAGGTTCCAGAGATTAGG + Intergenic
1000305172 5:159987961-159987983 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1001085540 5:168697719-168697741 CCTCTCAGGTCTCAGCTCTTGGG + Intronic
1002441937 5:179268928-179268950 CGTCTCAGGTTGCAGGGATCAGG - Intronic
1002443338 5:179275432-179275454 CCTCACAGCTGCCAGGGATGGGG - Intronic
1002583476 5:180225376-180225398 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1002609176 5:180402999-180403021 ATTCACAGGTCTCAGGGATTAGG + Intergenic
1002996679 6:2292527-2292549 CCTCTCAGGGGGCAGGGACTAGG + Intergenic
1003050299 6:2774621-2774643 AGTCACAGGTTCCAGGGATTAGG + Intronic
1003897339 6:10620107-10620129 ATTCTCAGGTTCCAGGGATTAGG + Intronic
1004265104 6:14142475-14142497 ATTCACAGGTACCAGGGATTAGG - Intergenic
1004320001 6:14624974-14624996 CCTCCCAGGTAGCTGGGATTAGG + Intergenic
1004345574 6:14846256-14846278 ATGCACAGGTCCCAGGGATTGGG - Intergenic
1005250327 6:23938217-23938239 ATTCACAGGTTCCAGGGATTAGG + Intergenic
1006019614 6:31110349-31110371 CCAGTCAGGTCCCTGGGAGTTGG - Intergenic
1006512521 6:34529294-34529316 GCTCACAGGTCCCAGGGAGTGGG + Intronic
1007032735 6:38642766-38642788 CCTTTCAGATCTCAGTGATTTGG - Intergenic
1007070131 6:39030342-39030364 CCTCTCAGGATCCAGTGATCCGG - Exonic
1007343021 6:41204369-41204391 AATCACAGGTTCCAGGGATTAGG + Intergenic
1007358614 6:41339747-41339769 CCTCACAGGTACCTGGGATTAGG + Intronic
1008676968 6:53829332-53829354 CCTCTCAAGTGCCAGACATTAGG - Intronic
1009353753 6:62714008-62714030 ATTCTCAGGTTTCAGGGATTAGG - Intergenic
1009400937 6:63254674-63254696 AGTCACAGGTTCCAGGGATTAGG + Intergenic
1009887881 6:69645731-69645753 ATTCTCAGGTTCCAGGGATTAGG + Intergenic
1010536302 6:77036080-77036102 ACTCTCAGGTTCCACAGATTAGG - Intergenic
1011493895 6:87920178-87920200 ACTCACAGGTACCAGAGATTAGG + Intergenic
1011877490 6:91978974-91978996 CCTCTCAAGTTCCAATGATTTGG + Intergenic
1012068785 6:94584581-94584603 CCTTTGTGGTCCCAGGTATTGGG - Intergenic
1012946600 6:105472978-105473000 ATTCACAGGTTCCAGGGATTGGG - Intergenic
1014187870 6:118456474-118456496 ACTCACAGGTTTCAGGGATTAGG - Intergenic
1014451960 6:121592186-121592208 AGTCACAGGTTCCAGGGATTAGG - Intergenic
1014807161 6:125843065-125843087 ATTCTCAGGTACCAGGGATTAGG - Intronic
1015605943 6:134954756-134954778 CCTGTCAGGCCCCACGCATTTGG - Intergenic
1016464774 6:144314533-144314555 CATATCTGGTCCCAAGGATTTGG - Intronic
1016822616 6:148360879-148360901 ACACTCAGATACCAGGGATTAGG - Intronic
1016887418 6:148970981-148971003 ATTCACAGGTCCCAGGGATTAGG + Intronic
1017134283 6:151134602-151134624 TCTCTCCGGTCTCAGGGACTGGG - Intergenic
1017466935 6:154703137-154703159 AGTCTGAGGTCCCAGGGGTTAGG + Intergenic
1017815074 6:158010632-158010654 CTTCTGAGGTCCCGGGGGTTAGG - Intronic
1018244374 6:161807860-161807882 ACTCACAGGTACCAGAGATTAGG + Intronic
1020104770 7:5417593-5417615 CCGCTCGGGTCCCAGGAATGCGG - Intronic
1020892212 7:13892576-13892598 ATTCATAGGTCCCAGGGATTAGG - Exonic
1020999799 7:15314697-15314719 ACTCACAGGTTCCAGGGATTAGG - Intronic
1021883072 7:25112499-25112521 ATTCACAGGTTCCAGGGATTAGG + Intergenic
1022528002 7:31050744-31050766 GCTCTCAGCTCTCAGGGGTTAGG + Intergenic
1022689801 7:32637669-32637691 GTTCACAGGTTCCAGGGATTAGG - Intergenic
1022900713 7:34807924-34807946 CATCACAGGTTCCAGGGATTAGG - Intronic
1023310485 7:38881459-38881481 ATTCACAGGTTCCAGGGATTAGG + Intronic
1023324551 7:39038980-39039002 GCTCTTAGTTCCCAGGGAATAGG + Intronic
1023485724 7:40684251-40684273 CATCACAGGTTTCAGGGATTAGG + Intronic
1024703498 7:51930225-51930247 AATCGCAGGTCCCTGGGATTAGG + Intergenic
1025252836 7:57363354-57363376 CCTCTCAGGACTCAGGGAACTGG + Intergenic
1026584769 7:71647327-71647349 TGCCTCAGGTCCCAGTGATTTGG - Intronic
1028378532 7:90173679-90173701 ATTCTGAGGTACCAGGGATTAGG - Intronic
1029593921 7:101526596-101526618 CCTCTCAGGGCCCAGGCCTTGGG + Intronic
1030507059 7:110437710-110437732 ATTCTCAGGTTCCAGGAATTAGG + Intergenic
1031022369 7:116642233-116642255 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1031161653 7:118176123-118176145 AATCACAGTTCCCAGGGATTAGG + Intergenic
1031520354 7:122757270-122757292 CCTCCCAAGTCCCAGCTATTTGG - Intronic
1031565674 7:123294398-123294420 ATTCTCTGGTTCCAGGGATTAGG - Intergenic
1032602063 7:133308273-133308295 AATCTGAGGTACCAGGGATTAGG - Intronic
1032716805 7:134515735-134515757 ATTCACAGGTGCCAGGGATTAGG + Intergenic
1032889994 7:136183805-136183827 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1033414263 7:141148322-141148344 ACTCACAGGTTCCAGCGATTAGG + Intronic
1034967899 7:155402824-155402846 ATTCTGAGGTCCCAGGGATCAGG + Intergenic
1036653991 8:10663737-10663759 CCTCTCAGGTCCCTGAGAAAGGG - Intronic
1037742091 8:21616198-21616220 CTTCACAGGCCCCAGAGATTGGG - Intergenic
1037899342 8:22678419-22678441 CCTCCCAGGTCTCAGGAATTGGG - Intergenic
1038030834 8:23637855-23637877 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1038049144 8:23792720-23792742 ATTCACAGGTTCCAGGGATTAGG + Intergenic
1039134588 8:34306481-34306503 GCTCACAGGGCCCAGGGATTAGG + Intergenic
1039226363 8:35392697-35392719 ACTCACAGGTTCTAGGGATTAGG + Intronic
1039830085 8:41206534-41206556 CTCCTCAGGTACCAGGGATTAGG + Intergenic
1042094235 8:65194776-65194798 ATTCACAGGTTCCAGGGATTTGG - Intergenic
1042104911 8:65315937-65315959 CTTCACAGGTCCCAGAGATTGGG + Intergenic
1042162046 8:65906179-65906201 ACTCACAGGTCCCAAGGATTAGG - Intergenic
1042350115 8:67768583-67768605 ATTCACAGGTCCCAGGGATTTGG - Intergenic
1042841376 8:73127183-73127205 ACTCACAGGTTCCAGGTATTGGG + Intergenic
1043230912 8:77800058-77800080 CCTCTCTGGTCCCAGGGCAAAGG - Intergenic
1043596387 8:81890978-81891000 ATTCACAGGTGCCAGGGATTAGG + Intergenic
1044217132 8:89625091-89625113 CCTTTCTGGTCCCAAGGACTAGG + Intergenic
1044756298 8:95465492-95465514 GCTCTCAGGTACCAGGAATGGGG + Intergenic
1044827015 8:96208432-96208454 AATCACAGGTTCCAGGGATTTGG + Intergenic
1045100706 8:98841019-98841041 CCCCTCAGGTCCCAGCCATGTGG + Intronic
1045400424 8:101811125-101811147 ACTCACAGGTTCCAGGGATTAGG - Intronic
1045458076 8:102401659-102401681 CGTCTCAGGTAGCAGGAATTTGG + Intronic
1046766502 8:118075194-118075216 TCTCTCTGGGCCCAGGAATTTGG - Intronic
1046802210 8:118440836-118440858 CCTCAGAGATCCCAGGAATTTGG + Intronic
1046886658 8:119375048-119375070 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1047215685 8:122874210-122874232 ATTCACAGGTTCCAGGGATTAGG + Intronic
1047366549 8:124216745-124216767 ATTCTCAGGTTCCAGGGATAAGG + Intergenic
1047718024 8:127613696-127613718 ATTCTCAGGTTCCAGGAATTTGG - Intergenic
1048306712 8:133289674-133289696 CCTCCCAGGTCCCAGGGTCACGG - Intronic
1048968486 8:139630642-139630664 CCTCTCAGGTCCGGGGACTTGGG + Intronic
1049976238 9:862881-862903 CTTCACAGGTTGCAGGGATTAGG - Intronic
1050397432 9:5214364-5214386 CCGCTGAGGCCCCAGGCATTAGG + Intergenic
1050890303 9:10816975-10816997 CCTCTCAGGGGCCATGGAATGGG + Intergenic
1052530653 9:29680506-29680528 ATTCTCAGGTACCAGGAATTAGG - Intergenic
1055961630 9:81826086-81826108 CCTCTCAAGTGCCAGGAAGTGGG - Intergenic
1056055029 9:82812879-82812901 ATTTTCAGGTCACAGGGATTTGG - Intergenic
1056542060 9:87580342-87580364 ATTCACAGGTCCCAGGGATTAGG - Intronic
1056626897 9:88261092-88261114 CCACTGAGGTCCTGGGGATTAGG + Intergenic
1057076336 9:92140148-92140170 CCTCTGAGGTCCCAGGTTTCTGG + Intergenic
1057199926 9:93134411-93134433 CGTCTCAGGCCCGAGGGGTTGGG - Intergenic
1058577106 9:106415563-106415585 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1058935665 9:109767376-109767398 ATTCACAGGTTCCAGGGATTAGG + Intronic
1059977376 9:119731873-119731895 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1060747616 9:126148084-126148106 CCTCTCTGGTCCCAGGCCTCAGG - Intergenic
1060982230 9:127799956-127799978 CATCTGTGGTCCCAGTGATTTGG - Intronic
1061247971 9:129411026-129411048 ATTCACAGGTTCCAGGGATTAGG + Intergenic
1061318225 9:129810959-129810981 AGTCTCACGTCCCAGGGATCAGG - Exonic
1061870146 9:133516120-133516142 CTTCTCAGGTCCCAGTGCTTAGG + Intronic
1062171656 9:135138070-135138092 CCTCTCTGAGCCAAGGGATTTGG + Intergenic
1062528692 9:136990037-136990059 ATTCACAGGTCCCAGGGATTAGG + Intergenic
1185770337 X:2761122-2761144 GTTCTGAGGTCCTAGGGATTAGG - Intronic
1185782542 X:2861928-2861950 ATTCACAGGTCCTAGGGATTGGG - Intronic
1186526054 X:10249387-10249409 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1186622859 X:11259899-11259921 ACTCACAGGTTCCTGGGATTCGG - Intronic
1186676015 X:11818235-11818257 ATTCCCAGGTTCCAGGGATTAGG - Intergenic
1186901969 X:14066212-14066234 CCTCTCAGGCTCCAGGGCGTGGG - Intergenic
1186910901 X:14164135-14164157 CCACTCAGGTGTCAGGGTTTTGG + Intergenic
1186967218 X:14801142-14801164 CTACTTAGGTCACAGGGATTTGG - Intergenic
1189077878 X:37937122-37937144 CTTCACAGGTCCTGGGGATTGGG - Intronic
1189097697 X:38157661-38157683 ATTCTCAGGTTCCAGGGACTAGG + Intronic
1189576587 X:42359967-42359989 TCTCACATGTTCCAGGGATTAGG + Intergenic
1189912912 X:45828997-45829019 GCTCACAGGTTCCAGGGATTAGG + Intergenic
1190229456 X:48570867-48570889 CCTCCCAGGTAGCTGGGATTTGG + Intergenic
1190266817 X:48831750-48831772 CCTCTTAGGCCCCAGGACTTAGG + Intronic
1190381331 X:49842050-49842072 ATTCATAGGTCCCAGGGATTAGG + Intergenic
1190558107 X:51658259-51658281 CCTCTCTGCTCCCATGGATAAGG - Intergenic
1190858868 X:54324317-54324339 ATTCACAGGTTCCAGGGATTAGG + Intronic
1192840295 X:74848533-74848555 ATTCACAGGTTCCAGGGATTAGG + Intronic
1194193165 X:90861301-90861323 CCTCTCAGGTCCGAGGGGAGGGG + Intergenic
1195323957 X:103743165-103743187 TCTCTCAAGTCCCTGGGTTTTGG + Intergenic
1195376799 X:104235548-104235570 ATTCACAGGTTCCAGGGATTAGG + Intergenic
1198377254 X:136052327-136052349 ATTCACAGGTTCCAGGGATTAGG - Intergenic
1198440077 X:136654576-136654598 CTTCTCTGGTCCCTGTGATTTGG + Intronic
1198729839 X:139717363-139717385 ATTCACAGGCCCCAGGGATTGGG - Intergenic
1199268885 X:145859606-145859628 CATCTCAGGGCTCTGGGATTAGG - Intergenic
1199412116 X:147536189-147536211 ATTCTGAGGTACCAGGGATTAGG - Intergenic
1199754531 X:150851941-150851963 ATTCACAGGTCCCAGAGATTAGG + Intronic
1200084581 X:153597649-153597671 ATTCACAGGTTCCAGGGATTAGG + Intronic
1200292223 X:154885407-154885429 CCTGTCAGGTCCCAGGGGCCGGG - Exonic
1200339060 X:155381144-155381166 CCTGTCAGGTCCCAGGGGCCGGG - Intergenic
1200347409 X:155459548-155459570 CCTGTCAGGTCCCAGGGGCCGGG + Exonic
1200355357 X:155544230-155544252 ATTCACAGGTACCAGGGATTAGG - Intronic
1200539779 Y:4443751-4443773 CCTCTCAGGTCCGAGGGGAGGGG + Intergenic
1200756236 Y:6992507-6992529 ACTCTCAGGAGCCAGGTATTAGG + Intronic
1201299920 Y:12496605-12496627 GTTCTGAGGTCCTAGGGATTAGG + Intergenic