ID: 944682973

View in Genome Browser
Species Human (GRCh38)
Location 2:202093794-202093816
Sequence TGTAAACTGTTTAGTATTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944682973 Original CRISPR TGTAAACTGTTTAGTATTAT GGG Intronic
900033775 1:390132-390154 TGTAAACTGCTGATAATTATGGG + Intergenic
900054610 1:620022-620044 TGTAAACTGCTGATAATTATGGG + Intergenic
903262410 1:22138591-22138613 TGTAAACTGTGAAGTACTGTGGG + Intronic
903935892 1:26894573-26894595 AGCAAACTGTTGAGAATTATCGG - Intronic
905094221 1:35455548-35455570 TCTTAAATGTTTAGTATTAGAGG - Intronic
908997329 1:70171243-70171265 TATAAAATGTTTAGAAGTATAGG + Intronic
909252311 1:73374230-73374252 TGTAAAATTTGTAGTATTCTAGG + Intergenic
909349388 1:74632205-74632227 TTTAAATTGTTTAGTTGTATTGG - Intronic
909911938 1:81270843-81270865 TGTAATTTGTGCAGTATTATTGG - Intergenic
910011811 1:82472987-82473009 TGCATATTGTTTAGTATTATTGG + Intergenic
910053073 1:82999088-82999110 TGTAAACTGTTTAGTAAATATGG - Intergenic
912352402 1:109026717-109026739 TATACAATGTTTAGTATCATTGG - Intronic
914987044 1:152469676-152469698 TGAAAACTGTTTGTTATTATAGG - Intergenic
921202680 1:212822402-212822424 TGAACACTGTTTAATATTTTGGG + Intergenic
921748138 1:218761176-218761198 AGAAAACTGTTTAGGATTATTGG + Intergenic
922256132 1:223894288-223894310 TGTAAACTGCTGATAATTATGGG + Intergenic
922959274 1:229632076-229632098 TTTAAAATGTTTATTATTAAAGG - Intronic
923516923 1:234705664-234705686 TCTAATCTGTTCAGTATAATGGG - Intergenic
924862568 1:247939756-247939778 TGTAAAAACTTTATTATTATTGG - Intronic
1062858694 10:793225-793247 TGTAAACAATTTAGTACTTTAGG + Intergenic
1063324924 10:5089105-5089127 TTAAATCTGTTTAGTATAATAGG + Intronic
1063476986 10:6337515-6337537 TGTGAACTGTTTATTGTTGTGGG + Intergenic
1064386205 10:14894037-14894059 TTTAAAATGTTTAGAATTAAGGG + Intronic
1064676682 10:17767149-17767171 TATAATTTGTTGAGTATTATGGG - Intronic
1064753123 10:18552521-18552543 TCTAATCTATTTAATATTATTGG + Intronic
1064907534 10:20362998-20363020 TTTAAACTGATTTGGATTATGGG - Intergenic
1065681679 10:28241183-28241205 TGTAAGGTCTTTAGTATTAATGG - Intronic
1065987985 10:30975542-30975564 TGGAACATGTTTAGGATTATTGG - Intronic
1066122975 10:32309417-32309439 TTTAAATTTTTTATTATTATGGG - Intronic
1066364320 10:34762198-34762220 AGTAAACTGTTTAGTAAAGTGGG - Intronic
1066387565 10:34954146-34954168 TGTAAACTGTAAAGTGCTATAGG + Intergenic
1067992641 10:51232511-51232533 TGTAAAATGTTTATTGTTATAGG - Intronic
1068101729 10:52562898-52562920 TCTTAACTTTTCAGTATTATGGG + Intergenic
1068510181 10:57955876-57955898 TGTGAACTATTCAGTAGTATAGG - Intergenic
1070370910 10:75780945-75780967 TCTTAACTCTTTAGTATGATTGG + Intronic
1070511602 10:77166345-77166367 TGCAACCTGTTTGGTGTTATAGG + Intronic
1072168021 10:92832585-92832607 TGTACACTCTTAAGCATTATGGG + Intergenic
1072813503 10:98482323-98482345 TGTAAGCTGTTTAGCATCCTTGG - Intronic
1075176585 10:120168967-120168989 TATAAACTGCTCAGTATTAAGGG + Intergenic
1079996688 11:27302997-27303019 TGTAGGCTCTTTAGAATTATTGG + Intergenic
1080131114 11:28795597-28795619 TTTAAACTCTTTATTTTTATTGG + Intergenic
1082735566 11:56851766-56851788 TGTAACTTGTTTTGCATTATGGG - Intergenic
1082933424 11:58632535-58632557 TGTAAACTCTTAAGAATTAAAGG - Intergenic
1084851362 11:71943870-71943892 TGTATGCAGTTTAGTATTACTGG + Intronic
1087339218 11:96881349-96881371 TGAAAACTGTTGAATATTCTAGG - Intergenic
1088134198 11:106534234-106534256 TGTAAACTGTTAAATATCATTGG - Intergenic
1088171145 11:106998208-106998230 TGTAAACTATGTAGTATTTCTGG + Intronic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1092022979 12:5217417-5217439 TGCAAACTGTTTAGAAATCTGGG - Intergenic
1093933163 12:24974430-24974452 TGTAAAATATTTAGAATTTTTGG + Intergenic
1095220736 12:39610932-39610954 TAAAAACTGCTTAGTATTTTAGG - Intronic
1095431080 12:42135326-42135348 TGTAAACTGTTTAGATGTATGGG + Intronic
1095523855 12:43101467-43101489 TGTAAACTTTGTAGAACTATTGG + Intergenic
1096313946 12:50546919-50546941 TTTTAATTGTTTTGTATTATAGG - Intronic
1097356065 12:58603248-58603270 TGTCAACTATTTATTAATATTGG - Intronic
1099644392 12:85333371-85333393 TTTCAACTTTTTAGTATTACTGG + Intergenic
1100434833 12:94561882-94561904 TGTTAACTGCCTAGGATTATAGG - Intergenic
1100577180 12:95903753-95903775 TATTATCTTTTTAGTATTATTGG + Intronic
1100612144 12:96200223-96200245 TTGAAACTATATAGTATTATAGG + Intronic
1100782243 12:98040493-98040515 AGTAAACTGTTTAGTAAAAGTGG - Intergenic
1102129868 12:110518659-110518681 TCAAATCTGTTTAATATTATGGG - Exonic
1102720299 12:115010220-115010242 TGTAAGCTGTGTAGTGTTACTGG + Intergenic
1104549754 12:129745618-129745640 TGGTAACTGTTTAGTGTTAATGG - Intronic
1105413149 13:20188354-20188376 TGAAAACTTTGTAGTATGATAGG - Exonic
1107365313 13:39666475-39666497 TTTAAATGGTTTAATATTATGGG + Intronic
1108907115 13:55490129-55490151 TGTGAAATGTTTACTTTTATTGG - Intergenic
1109848345 13:68027304-68027326 TGTAAAATGTTTAGTGACATTGG - Intergenic
1110105342 13:71668166-71668188 TGTAAAATGTTTAATATTAAAGG - Intronic
1110645149 13:77874003-77874025 TGTAAACTGGTTAAAATCATAGG - Intergenic
1111807532 13:93056103-93056125 TGTAAAGTGTTTTGTCATATTGG - Intergenic
1112160832 13:96866337-96866359 TATAAACTGTTTAGTCATATGGG - Intergenic
1112866075 13:103900067-103900089 TGTAATCAGTTTAGAATAATGGG + Intergenic
1112912031 13:104498139-104498161 TGTAAGCTGTATACTATTAATGG + Intergenic
1113127035 13:106990716-106990738 TTTAAAATGTTTAGTCTTCTTGG - Intergenic
1114129556 14:19774562-19774584 TGTAAACAGAGTACTATTATGGG + Intronic
1114598770 14:23936651-23936673 TGGAAACTGTTTAGTAGGGTTGG + Intergenic
1116328507 14:43565861-43565883 TCTAGACTTTTTATTATTATAGG - Intergenic
1117558241 14:56908617-56908639 TTTAAATTTTTTAGTTTTATAGG + Intergenic
1118583832 14:67332029-67332051 TATAAATTGTTTTGTACTATGGG + Intronic
1120335972 14:83155358-83155380 TATAAAATGATTAGAATTATGGG + Intergenic
1120338148 14:83185655-83185677 TGTCATCTGTTTACGATTATAGG + Intergenic
1120379529 14:83757653-83757675 TGGAAAAAGTTTAATATTATGGG - Intergenic
1120399885 14:84017544-84017566 TGCAAACTTTATAGCATTATTGG - Intergenic
1120510314 14:85405333-85405355 TGTAAGCTTATTAGTATTGTAGG + Intergenic
1120870906 14:89336758-89336780 AGTAAGCTGTTTAGCACTATAGG - Intronic
1121343710 14:93119921-93119943 TCTAAAATGTGTGGTATTATGGG + Intergenic
1121355398 14:93209680-93209702 TGTAAACTTTTTAGTCTTAATGG + Intronic
1126408808 15:48350727-48350749 TGTAAAATATATAGTTTTATTGG + Intergenic
1126495593 15:49286701-49286723 TGTAAACTTTTTAATATCAAGGG + Intronic
1129100048 15:73253028-73253050 TGTATTCTTTTGAGTATTATTGG - Intronic
1130189383 15:81718125-81718147 TATAAACTGTTTAGAAATAATGG + Intergenic
1131485504 15:92816724-92816746 TGTATACTGTTTTGTATTGTTGG + Intergenic
1139145698 16:64322220-64322242 GGTAAACTTTTTGGTATTGTTGG - Intergenic
1140591222 16:76355040-76355062 TTTAAAATGTTTAATATGATAGG - Intronic
1202997478 16_KI270728v1_random:129384-129406 TGTACACTTTTTTGTATTTTAGG - Intergenic
1203024165 16_KI270728v1_random:441726-441748 TGTACACTTTTTTGTATTTTAGG - Intergenic
1144442728 17:15298416-15298438 TGTAAATAGTTTAGTAGTCTAGG + Intergenic
1146817977 17:35959655-35959677 TTTAAAATGCTTAATATTATAGG + Intergenic
1147000263 17:37357595-37357617 TTTAAAATGTTTAATATTCTTGG + Intronic
1150062755 17:62082973-62082995 TGTAAATTGCTTAGCACTATGGG - Intergenic
1150180167 17:63110963-63110985 TGTTACCTGTATTGTATTATTGG + Intronic
1154142687 18:11839070-11839092 TGTAAACTGTTCATTATGATGGG + Intronic
1155612901 18:27687846-27687868 GGAAAACTGTTTGGTAGTATTGG - Intergenic
1158578641 18:58661950-58661972 TTTAAATTGTTTATTTTTATGGG + Intergenic
1158684904 18:59604775-59604797 TGTACACTGTCTAGTTTTGTTGG + Intronic
1159244203 18:65783802-65783824 TGTAAACTGTGTCATATTCTTGG - Intronic
1159333779 18:67036393-67036415 AGTTAAATGTTTAGTTTTATAGG + Intergenic
1162869065 19:13572085-13572107 TGTAAACATGTTAATATTATAGG + Intronic
1164663378 19:30000528-30000550 AGTAGACTGTTTAGAATTCTAGG + Intronic
1164914012 19:32035431-32035453 TGTGAACAGTTTAGTCTGATGGG - Intergenic
1165766692 19:38356065-38356087 TACAAACAGTTTATTATTATTGG + Intronic
1168638007 19:58011173-58011195 TGTAAACTGTTTTCTATTTGCGG + Exonic
925968343 2:9087376-9087398 AGAAAACTGTTTAGAATTGTTGG - Intergenic
928461431 2:31476794-31476816 TGTAAATTGCTAAGTATTAGAGG + Intergenic
930865363 2:56117555-56117577 TGTAAATTGTTTAGGATTCCTGG - Intergenic
932923585 2:75944370-75944392 TGTAAACTATTGAGCATTTTAGG + Intergenic
933352534 2:81173124-81173146 TATAAAGTGTTTATTTTTATAGG - Intergenic
933551882 2:83788111-83788133 TGGAAAGTGTTTAGTAGTACAGG + Intergenic
935319751 2:101874566-101874588 TGTACACTATTGAGTATAATGGG - Intronic
936444059 2:112582424-112582446 TGTAAACTGTTTGATTTAATGGG + Intergenic
938241652 2:129746999-129747021 GGTTAACTGTTTTATATTATGGG + Intergenic
939658923 2:144863106-144863128 TGAAAACTCTTTAGTTTTATAGG + Intergenic
939737039 2:145859600-145859622 TCTAAACATTTTAGAATTATAGG + Intergenic
940721915 2:157291672-157291694 TGTAAACAATCCAGTATTATTGG + Intronic
941193283 2:162414170-162414192 TGTAAATTGTTAAGCATTTTTGG + Intronic
941859716 2:170266288-170266310 TTAGAACTGTTTAGTTTTATGGG - Intronic
942933027 2:181519128-181519150 TGTAAAATGTTTCTTATCATTGG - Intronic
943085308 2:183303812-183303834 GTTAATCTGTTTATTATTATAGG + Intergenic
943846736 2:192659191-192659213 TTTTAACAGTTTAGTATTACTGG - Intergenic
944682973 2:202093794-202093816 TGTAAACTGTTTAGTATTATGGG + Intronic
947020328 2:225667404-225667426 TGCAAGCAGTTTAGCATTATAGG + Intergenic
1169713011 20:8585505-8585527 TGGAAGCTGTTTAGTATTATTGG - Intronic
1170037046 20:12000713-12000735 TGAAAACTGTTGAGTATCAAAGG + Intergenic
1170915619 20:20621717-20621739 TTTAAATTGTTTAACATTATTGG - Intronic
1172987087 20:39000337-39000359 TGTGAACTGTTTACTCTTTTGGG + Intronic
1173708001 20:45127646-45127668 TGTAAAATATTTAGTAATAAAGG + Intergenic
1174738511 20:52988294-52988316 TGTAAGCTGGTTATGATTATTGG + Intronic
1174761584 20:53211935-53211957 TTGATAATGTTTAGTATTATAGG + Intronic
1176890672 21:14314618-14314640 AGACAACTGATTAGTATTATTGG - Intergenic
1178108208 21:29344999-29345021 TATAAACAGTTTAGCATTAAGGG + Exonic
1178178957 21:30137582-30137604 TCTAAACTCTTTACGATTATAGG - Intergenic
1179277826 21:39908157-39908179 TGTTAACTGTGTAGTGTAATTGG + Intronic
949448087 3:4156582-4156604 TAAAAACTGTTTAGTTTTCTGGG + Intronic
949764727 3:7513741-7513763 TTTAAAATTTTTATTATTATGGG - Intronic
953225444 3:41014866-41014888 TGCAAACTTTTTCTTATTATTGG - Intergenic
953596278 3:44317789-44317811 AGTAAACTGTTTCTTATTCTTGG + Intronic
954504575 3:51056907-51056929 TGTAAAGTTTTTAGTACTAGTGG + Intronic
954670194 3:52286932-52286954 AGTGAACTGTTTTGTATTTTTGG + Intronic
955585005 3:60468517-60468539 TGTCATCTGTTTAATATAATGGG - Intronic
955772875 3:62404130-62404152 TGTAAATTGTTTGGTATAAGCGG - Intronic
956224529 3:66941593-66941615 AATATACTGTTTAGTATTAAAGG + Intergenic
956722541 3:72131111-72131133 GGTAAATAGTTTAGTTTTATTGG + Intergenic
957442598 3:80269522-80269544 TATAAACAGTTTAATATCATAGG - Intergenic
957872428 3:86106817-86106839 AGTAAACTGTTTTCTTTTATGGG - Intergenic
959796671 3:110439302-110439324 TTTAAAATGTTTAGTGTAATTGG + Intergenic
962162705 3:133016056-133016078 AGGAGACTGTTTATTATTATTGG + Intergenic
962638968 3:137363214-137363236 TCCAATCTGTTTATTATTATGGG - Intergenic
963147793 3:142012310-142012332 TTTAAAATGTGTAGAATTATAGG - Intronic
963428166 3:145159020-145159042 TGTAAATTGCTTAGTAGTAATGG - Intergenic
964566224 3:158056471-158056493 TCTAAACTTTTTAGTACTTTAGG + Intergenic
965107100 3:164370777-164370799 TGTAAAATGTTTCTTATTATTGG + Intergenic
969291825 4:6245121-6245143 TGTAAATTGTTGAGTACAATGGG - Intergenic
970466704 4:16330945-16330967 TGTAAACTGCTGAATAATATGGG - Intergenic
973928117 4:55760652-55760674 TGTTAACTGTTTTGTCTTTTTGG - Intergenic
974728581 4:65831012-65831034 AGTACTCTGTTTTGTATTATAGG + Intergenic
977183468 4:93906064-93906086 TCTATAGTGTTTAGAATTATGGG - Intergenic
978364668 4:107968853-107968875 TGAAAAATGTTTTATATTATTGG - Intergenic
978881626 4:113710327-113710349 TGCAAACTGTTTATTATGACTGG + Intronic
978962311 4:114696943-114696965 TGTAAACTATTAAGTCTTTTTGG - Intergenic
979239795 4:118438154-118438176 TGTAAACTGCTGATAATTATGGG - Intergenic
982766041 4:159349712-159349734 TGGAAACTGTTTTGTATCCTTGG - Intronic
982975093 4:162046444-162046466 TGTAAACTCTTTAATCTTTTGGG + Intronic
983458659 4:167998504-167998526 AACAAACTGTTTAGTCTTATGGG + Intergenic
983695615 4:170526199-170526221 TGTATACTGTTGAGTTTTAAGGG - Intergenic
983768768 4:171521098-171521120 TGTAAACAGTTTAATCTTTTCGG - Intergenic
983976507 4:173940924-173940946 TGTATGCTTTTTAATATTATGGG + Intergenic
984382216 4:179009513-179009535 TGTATTCTCTTTATTATTATAGG - Intergenic
985279850 4:188275044-188275066 TGTAAACTCTTTAGTTTTGTTGG - Intergenic
986384918 5:7223973-7223995 TGTTTACTGTTTAGTATCTTGGG + Intergenic
986562711 5:9078882-9078904 TGCAAACTATTTACTATTAGTGG - Intronic
987581088 5:19793473-19793495 TGTACACTGTATTTTATTATGGG + Intronic
988151829 5:27393086-27393108 CTTAAACTGTATATTATTATTGG - Intergenic
991217565 5:64172931-64172953 TGTCAACTGTTTAGAATTCAGGG + Intronic
992185899 5:74244134-74244156 TATAAAGTGTTTATAATTATTGG - Intergenic
992670735 5:79058125-79058147 TGTAAATTGTTTAGTAGAACTGG - Intronic
994361599 5:98856113-98856135 TGGAAAATGTTTACTATTACAGG - Exonic
994698097 5:103098295-103098317 TGTAAAGTGTCTAGTGTGATGGG - Intronic
997031133 5:130130087-130130109 TGTAAACTGTTTATTCTATTAGG + Intronic
998288609 5:140889673-140889695 TTTAAACCTTTTAGTATTATGGG + Intronic
998562583 5:143185120-143185142 TGATAACTGTTTATTAATATGGG + Intronic
1002740045 5:181428736-181428758 TGTAAACTGCTGATAATTATGGG - Intergenic
1005559216 6:27020524-27020546 TGTACACAGTTTATTGTTATTGG + Intergenic
1005772442 6:29087578-29087600 TCTAAACTGTTTATTAAGATAGG - Intergenic
1006190214 6:32202867-32202889 TATTAACTGTTTAGTCTTCTAGG - Intronic
1006287641 6:33109523-33109545 TGTAAACATTTTTGTATGATGGG + Intergenic
1006613373 6:35309182-35309204 TGCAAACTGTCTAGCATTGTGGG + Intronic
1006973021 6:38066535-38066557 TGTAAACTATTTAGTAGTTATGG + Intronic
1007522461 6:42461831-42461853 TTTACTCTGTTTAATATTATGGG - Intergenic
1007889588 6:45274416-45274438 TATAAAATGTTTAGAAATATAGG - Intronic
1008004636 6:46397683-46397705 TGAAAAGTGTTTAATATTATAGG - Intronic
1009298512 6:61985222-61985244 TGGAAACTTTTTAGTAATATGGG + Intronic
1009600870 6:65796951-65796973 TTTAAACTCTGTTGTATTATTGG + Intergenic
1010849950 6:80761421-80761443 TGTTAACTGTTTATTAATTTTGG + Intergenic
1011511722 6:88108727-88108749 TGTAGACTGTTTGGTAGTATAGG + Intergenic
1014083519 6:117314924-117314946 TCTCAAATGTTTAGTATTCTTGG - Intronic
1015796442 6:137016645-137016667 TCTAAGCTGTTTGGAATTATAGG - Intronic
1016218530 6:141634856-141634878 TGTAAACTGTTTATTTCTTTGGG + Intergenic
1016868853 6:148797097-148797119 TCTAAACTATTAAGAATTATCGG - Intronic
1018520512 6:164644820-164644842 TGTTAACTTTATATTATTATAGG + Intergenic
1018559026 6:165082057-165082079 TGAAAACTAGTTAGTAGTATGGG + Intergenic
1019245157 6:170704336-170704358 TGTAAACTGCTGATAATTATGGG - Intergenic
1020378040 7:7509983-7510005 TTTAAAGTGTTTAGTTTCATGGG + Intronic
1020492679 7:8808201-8808223 TATAAACTATTAACTATTATGGG - Intergenic
1020571054 7:9862090-9862112 TCTAAACTGTTAATTATTCTGGG - Intergenic
1021321157 7:19213684-19213706 TATAAAGTGTTTAAAATTATTGG + Intergenic
1022458608 7:30582112-30582134 ATTAAACTATTTAATATTATAGG + Intergenic
1026474471 7:70722820-70722842 TTCAAACTGTTGAGTATTTTAGG + Intronic
1027373572 7:77532363-77532385 TTTAAAATGTTTCGTCTTATTGG - Intergenic
1027499851 7:78935776-78935798 TGTAAACTGTAAAGTTATATTGG + Intronic
1028222888 7:88218030-88218052 TGAAAACTGTAGAATATTATGGG - Intronic
1028803496 7:94996656-94996678 TGTCACTTGTTTACTATTATAGG + Intronic
1030550666 7:110954996-110955018 TGTAAACAGTTTAGCAGTATAGG - Intronic
1030587467 7:111438197-111438219 AGTAAACAATTTAGTATTTTTGG - Intronic
1033135654 7:138781979-138782001 TTTACACTGTTAAGAATTATTGG - Intronic
1034017956 7:147607828-147607850 TGTAAAATTTTTATTATTGTTGG - Intronic
1034924148 7:155107558-155107580 TGAAAACTGTTTTGTGTTAGAGG + Intergenic
1035502966 8:103866-103888 TGTAAACTGCTGATAATTATGGG + Intergenic
1037059364 8:14487240-14487262 TGTAAACGCTTTATTTTTATTGG + Intronic
1041616586 8:59914677-59914699 TGTAAAGGCTTTATTATTATTGG - Intergenic
1041767549 8:61434778-61434800 TGTAAACTGTTTCTTATCATTGG + Intronic
1043611803 8:82073431-82073453 TGAATACTTTTTAGTATTAAAGG - Intergenic
1044266921 8:90192673-90192695 TGTATACTGTGAAGTATCATAGG + Intergenic
1044291261 8:90473072-90473094 AGTAAATTATTAAGTATTATAGG + Intergenic
1046046307 8:108968907-108968929 TGTGAACTGTTTATTATTACTGG + Intergenic
1048619390 8:136115014-136115036 TGTAGACTATTTAGTCATATTGG + Intergenic
1050251832 9:3752931-3752953 TTTAATCTGGTTAATATTATTGG + Intergenic
1050912839 9:11095527-11095549 TGTTAACTGTTTTCTATTCTTGG + Intergenic
1051651065 9:19325156-19325178 TAAAAAATGTTTAGTTTTATGGG + Intronic
1051763393 9:20495174-20495196 TGTAAAAAGTTTAATAATATGGG + Intronic
1052571455 9:30229298-30229320 TCTTAACTGTCTAGTTTTATTGG - Intergenic
1053380697 9:37647888-37647910 TGTAAAGTATTTAGCAGTATAGG + Intronic
1054735269 9:68744469-68744491 TTTAAAATGTCTAGTATCATGGG + Intronic
1054839257 9:69718248-69718270 CATGAACTGTTTACTATTATTGG - Exonic
1058167137 9:101633011-101633033 TGTGAATTGTTCAGTATTAATGG + Intronic
1060864529 9:126984877-126984899 TGAAGACTGCTTAGTATTACTGG + Intronic
1203605352 Un_KI270748v1:53544-53566 TGTAAACTGCTGATAATTATGGG - Intergenic
1185945507 X:4371260-4371282 TGGGAACTGTATTGTATTATGGG + Intergenic
1186033466 X:5394544-5394566 TTTAATCAGTTTAGTATTCTAGG + Intergenic
1186157943 X:6745385-6745407 GGTAAATTGTTTAGTAGTCTTGG + Intergenic
1186655863 X:11611287-11611309 TGTAAAGTGTCTTTTATTATGGG - Intronic
1188329614 X:28852941-28852963 TGAGAACTCTTTATTATTATGGG + Intronic
1188923214 X:36004905-36004927 TGTAATCTGTTTGCTGTTATAGG + Intergenic
1189942402 X:46138351-46138373 GGTAAACTGTTTAGTATTTTGGG - Intergenic
1190183312 X:48213038-48213060 TGTAAACTGTTTAGAATATATGG - Intronic
1191582849 X:62784272-62784294 TGTATACAGTTTTTTATTATAGG + Intergenic
1191669216 X:63733701-63733723 TGAAAACTGGATAGTATAATGGG - Intronic
1192268748 X:69558567-69558589 TGCAAACTGTTTAACATTCTTGG + Intergenic
1192672520 X:73160920-73160942 GGTAACTTGTTTAGTTTTATTGG + Intergenic
1196563996 X:117183067-117183089 TGAAAACTGTTTATGATTAGTGG + Intergenic
1198398429 X:136246534-136246556 TTTAAAGTGTTTACTATGATGGG + Intronic
1202387538 Y:24339984-24340006 TGTAAACTGCTGATAATTATGGG - Intergenic
1202483248 Y:25330144-25330166 TGTAAACTGCTGATAATTATGGG + Intergenic