ID: 944684272

View in Genome Browser
Species Human (GRCh38)
Location 2:202104510-202104532
Sequence TGGTTTTCACAGAAGGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 315}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944684263_944684272 27 Left 944684263 2:202104460-202104482 CCAGCCTCCAGGAGGCAGAAGGC 0: 1
1: 0
2: 6
3: 65
4: 381
Right 944684272 2:202104510-202104532 TGGTTTTCACAGAAGGAATATGG 0: 1
1: 0
2: 0
3: 29
4: 315
944684267_944684272 20 Left 944684267 2:202104467-202104489 CCAGGAGGCAGAAGGCAGGGAGC 0: 1
1: 1
2: 9
3: 150
4: 803
Right 944684272 2:202104510-202104532 TGGTTTTCACAGAAGGAATATGG 0: 1
1: 0
2: 0
3: 29
4: 315
944684265_944684272 23 Left 944684265 2:202104464-202104486 CCTCCAGGAGGCAGAAGGCAGGG 0: 1
1: 1
2: 6
3: 81
4: 622
Right 944684272 2:202104510-202104532 TGGTTTTCACAGAAGGAATATGG 0: 1
1: 0
2: 0
3: 29
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944684272 Original CRISPR TGGTTTTCACAGAAGGAATA TGG Intronic
900362560 1:2296826-2296848 AGGTTTTCACAGCAGGAACGTGG - Intronic
906889877 1:49698489-49698511 TGGTTTTCTCAGATGTAAAATGG - Intronic
906973288 1:50541861-50541883 TCATTTTCACAAAAAGAATATGG - Intronic
907179341 1:52555447-52555469 TGGTTCTGACACAAAGAATAAGG + Intergenic
907669417 1:56461651-56461673 TGTTTTTCACACAGGGAATGGGG - Intergenic
908564571 1:65341249-65341271 TGGTTTCCAAAGAAGGAACTAGG - Intronic
910085492 1:83396907-83396929 TAGTATTCAAAGAAGCAATAGGG - Intergenic
911595638 1:99795760-99795782 TGATTTTCATACAAGGTATAAGG + Intergenic
912194564 1:107382159-107382181 TTGTTATCAAAGAAGGAAGAAGG + Intronic
912334286 1:108847709-108847731 TGGGTGTTGCAGAAGGAATAGGG - Intronic
912933532 1:113984032-113984054 TGATTTTCATGGAAGTAATAAGG - Intergenic
913601015 1:120421185-120421207 TGTGTTTCAGAGAAGGAAGAAGG + Intergenic
914412635 1:147446054-147446076 GGGTTTACACAGAATGAATGTGG - Intergenic
915773148 1:158451921-158451943 TTGTTTTCATAGAATGAATTAGG - Intergenic
916477051 1:165179745-165179767 TGGTTTTTACAGAGAGAATGTGG + Intergenic
916799671 1:168204609-168204631 TGTGTATAACAGAAGGAATAAGG - Intergenic
917112899 1:171569618-171569640 TATTTTTCACAGGAGGTATAAGG - Intronic
918588478 1:186214773-186214795 GGGTTTTCTCAGAATGGATATGG - Intergenic
918635480 1:186769184-186769206 AGATTTTCACAAAAGAAATAAGG - Intergenic
919674367 1:200366742-200366764 TGGGTTGCACAGAAGGCACAGGG + Intergenic
920388601 1:205584926-205584948 TGGATGGCAAAGAAGGAATAAGG - Exonic
922560532 1:226565951-226565973 TGTTTATCACAGAAAGAGTAAGG - Intronic
924517504 1:244779087-244779109 TGGTTATCACAGCAGGAAGATGG + Intergenic
924750038 1:246878692-246878714 TTGTATTCACAGAACGTATAGGG - Intronic
1063015600 10:2073942-2073964 TGGTTTTAAGAGTAGGAATATGG - Intergenic
1063251058 10:4275275-4275297 TGGTTTTCCTTGAAGGAAAAGGG - Intergenic
1063697801 10:8354184-8354206 TGGTTTTCTGGGAAGGAATTAGG - Intergenic
1065517142 10:26535245-26535267 TTCTTTTCAAAGAAGGAAGAAGG - Intronic
1066409833 10:35156740-35156762 TGGTTTTCTTAAAAGGTATAGGG + Intronic
1067055861 10:43049492-43049514 TGGTTTTCTCAGCAGGGATGTGG - Intergenic
1068037464 10:51779000-51779022 GGGTTTTCTCAGAATGAAGATGG + Intronic
1068272689 10:54749493-54749515 TGGGTTTCACAAAAGGAACTGGG - Intronic
1069070813 10:63988924-63988946 TAGCTTTCCCAGAAGAAATAGGG - Intergenic
1070560353 10:77561766-77561788 AGGGTTTCAGAGAAGGGATAAGG + Intronic
1070590418 10:77796782-77796804 TGGTGTTCACAGAGGGCATGGGG - Intronic
1076349609 10:129807043-129807065 TGGTTTTCAAAGCAGGCATCAGG - Intergenic
1076540388 10:131210725-131210747 TGGTTAGCAAAGAAGGAATAAGG - Intronic
1077089795 11:773227-773249 AGGCTTTCCCAGAAGGAATCAGG + Intronic
1079397591 11:20078858-20078880 TAGTAATCACAGAAGTAATATGG + Intronic
1079961445 11:26929006-26929028 TGGTTCTCACATAAGAAATGGGG + Intergenic
1080180735 11:29422905-29422927 TGGTGTAGACAGAGGGAATATGG - Intergenic
1080515932 11:33020101-33020123 AGGTTTTCACAGTAGGACTAGGG + Intronic
1081957765 11:47108414-47108436 TGGACTTCACAGAAGAAATCAGG - Intronic
1082631150 11:55543979-55544001 AGGTGTTCAGAGAAAGAATAGGG - Intergenic
1083350680 11:62026618-62026640 TGGCCTTCACTGAAGGAATAAGG - Intergenic
1083628219 11:64082698-64082720 TGGGTCTCACACAAGGAATGTGG + Intronic
1084919213 11:72455540-72455562 TGGATTTAACAGAATGGATATGG + Intergenic
1085214612 11:74817847-74817869 TGGTTTTCAAATATGGACTAGGG + Intronic
1085775327 11:79360526-79360548 TGATTTTGAAGGAAGGAATATGG - Intronic
1087588918 11:100159434-100159456 TGGATTTCTCAGAACGAATATGG + Intronic
1090956430 11:131516881-131516903 TGGTTTCCACAGTAGATATAGGG + Intronic
1093347486 12:18056839-18056861 TGGTTCTCACAGAAGTATTCTGG - Intergenic
1093654540 12:21679643-21679665 TGATGATCACAGAAGGTATATGG + Intronic
1094721705 12:33072032-33072054 TGGGTTTCATATCAGGAATACGG - Intergenic
1096879783 12:54658370-54658392 TGTTTTTCACAGGAGGAAACGGG - Intergenic
1098335032 12:69395183-69395205 TTATTTTCACAGAAGGAAGAAGG + Intergenic
1098400904 12:70074664-70074686 TGGTTTTCACAGGAAGGAAATGG + Intergenic
1098810439 12:75082605-75082627 TGCTTTTCACAGTAAAAATATGG + Intronic
1098811719 12:75102975-75102997 AGGTTTTCACAGTAGGAGAAAGG + Intronic
1099643865 12:85325487-85325509 TTTTTTTCCTAGAAGGAATAAGG + Intergenic
1099673473 12:85726202-85726224 TGGTTGTCACAGATGGGGTAAGG - Intergenic
1100019752 12:90055115-90055137 GCTTATTCACAGAAGGAATAAGG - Intergenic
1100521212 12:95377808-95377830 TGGGTTTCACAGGAAGATTAAGG - Intronic
1101304910 12:103518739-103518761 AGGTTTGGACAGAAGAAATACGG - Intergenic
1101503427 12:105325516-105325538 TGGTTTTTAAAGAATAAATAAGG + Intronic
1101623506 12:106415414-106415436 TGGTTGTCACAGAGGGATGATGG + Intronic
1104853352 12:131889594-131889616 TGGTTCTCTCTGAAGGAAAAGGG + Intergenic
1106856214 13:33856134-33856156 TGGTTTTCATATATGGTATAAGG + Intronic
1108984442 13:56566791-56566813 TGGTTTTCAAAGAAATGATATGG - Intergenic
1110287762 13:73769638-73769660 TGGTTTTCAGAGAAGATCTAAGG - Intronic
1110556215 13:76862282-76862304 TGGTGTTCAGAGAAGTAATGTGG - Intergenic
1111358519 13:87143038-87143060 TGGTATTTGCAGAAAGAATAGGG - Intergenic
1111762183 13:92480382-92480404 TGTTTTTCAAATAAGGATTATGG + Intronic
1111790968 13:92854056-92854078 TGGTTTTAACACAAAGAACATGG - Intronic
1113033550 13:106022350-106022372 AGTTTTTCTCAGAAGGAAGATGG - Intergenic
1114996131 14:28354335-28354357 TAGTTTTAACATCAGGAATAAGG + Intergenic
1119032643 14:71204651-71204673 TAGATTTCACAGGAGGAATAAGG - Intergenic
1120440282 14:84528265-84528287 TGGTTGTAAAAAAAGGAATAAGG - Intergenic
1120952921 14:90059648-90059670 TGGTTTTCTCTGGAGGAATGTGG + Intergenic
1121402358 14:93691039-93691061 TGATGTTCACAAAAGGAATTAGG + Intronic
1125097000 15:35866352-35866374 TGGATTTCACAGAAAGACAAAGG + Intergenic
1125807315 15:42504966-42504988 TAATTTTCAGAGAAGGAATAAGG + Intronic
1127234252 15:57031094-57031116 TTGTATTCTCAAAAGGAATAGGG + Intronic
1127673951 15:61222738-61222760 TTGTTTTCACTGGACGAATATGG - Intronic
1128336692 15:66790844-66790866 TGGTTTTCTCATAAGTAAAATGG + Intergenic
1128729071 15:70008385-70008407 TGGATTTCAGAAATGGAATATGG + Intergenic
1128928329 15:71679528-71679550 GGCTTTTCTCAGAAGAAATAGGG + Intronic
1129090666 15:73147005-73147027 TGTGCTTCACAGAAGGAATGTGG + Intronic
1130441581 15:83960215-83960237 TGGGTTTCAAAGGAGGAAAATGG - Intronic
1132183346 15:99779624-99779646 TGTTTTTCAAATAAGGATTATGG - Intergenic
1132435090 15:101793857-101793879 TGTTTTTCAAATAAGGATTATGG + Intergenic
1134813784 16:17189176-17189198 TGGTGTTGAGAGAAGGAAGAAGG + Intronic
1138010124 16:53371636-53371658 TGTTGATCACTGAAGGAATAAGG - Intergenic
1139274792 16:65717367-65717389 TGGTTGACACAGAAGCAATTGGG + Intergenic
1139712974 16:68790564-68790586 TGATTTTCTCAAAAAGAATAAGG - Intronic
1143594252 17:7904965-7904987 TGGTGTTCCCAGAAGGACCAAGG + Intronic
1147039109 17:37703705-37703727 TGATTTTGGCAGAAGGAAAATGG - Intronic
1148997771 17:51726152-51726174 TGGTTTTCAGAGAAGAAACTGGG + Intronic
1149422061 17:56520763-56520785 TGCTTTTCACAAAAAGTATAAGG - Intergenic
1151085625 17:71377263-71377285 TGGTTTTCACTGAGGAAACATGG - Intergenic
1153236653 18:2994846-2994868 TGGTTTAAACAGATGGTATATGG + Intronic
1153369347 18:4296585-4296607 TGGTTTTCACAACAGGATTTAGG - Intronic
1153847815 18:9065589-9065611 TTGTTTTGACAGAAGAATTAAGG + Intergenic
1154128353 18:11714168-11714190 TGCGTTTCACTGATGGAATATGG - Intronic
1155169241 18:23254976-23254998 TGGTTTTCACAGAAAGGAATAGG + Intronic
1155803172 18:30134550-30134572 TTGTTTTAATAGATGGAATAAGG - Intergenic
1156212144 18:34956207-34956229 TGTTTTTCACATAATGGATATGG + Intergenic
1156674755 18:39514207-39514229 TTGTTATCACAGAAGAAAAATGG + Intergenic
1156728743 18:40163236-40163258 TAGGTTTCAGAGAAGAAATATGG + Intergenic
1157614487 18:48978546-48978568 TGGGTTCCACAGAAGCAATGGGG - Intergenic
1158594863 18:58807215-58807237 TGGTTTTCACAGGAGGGGTTGGG - Intergenic
1158673409 18:59497524-59497546 TGGATTTCACAGAATAGATAAGG + Intronic
1159458742 18:68695140-68695162 TGGTTTTCAGAGGAGTAATGGGG - Intronic
1163599753 19:18241857-18241879 TTGTTTTCCCAGCAGGAAAATGG - Intronic
1165178535 19:33948022-33948044 TGAGTTTTACAGAATGAATAGGG - Intergenic
1168288125 19:55344545-55344567 CGGTTTTCAGAGAAGAAAGATGG - Intronic
1168506144 19:56936840-56936862 TGGTGTGCACAGCAGGAAGAGGG - Intergenic
925041302 2:733355-733377 GGGTTTTCGTAGAAGGAATATGG - Intergenic
925283609 2:2701896-2701918 TGGTTTCCACGGAAGGGAGATGG - Intergenic
925339274 2:3124904-3124926 TGGATTTCACAGCAGTAATGAGG - Intergenic
925896052 2:8473116-8473138 TGGTGTTGAGATAAGGAATACGG + Intergenic
926037581 2:9647256-9647278 TGGGTTTTAAAGAATGAATAAGG + Intergenic
926867468 2:17375615-17375637 TGCTTATCACAGAAAGAGTAGGG + Intergenic
927719922 2:25376106-25376128 TGGTCATCACGGAAGGAAGATGG - Intergenic
928513495 2:32023124-32023146 TGGTTGTCACAACTGGAATAAGG - Intronic
929049477 2:37823793-37823815 TGGTTTTCAAAGGAAAAATATGG + Intergenic
929552002 2:42900116-42900138 TGCATTTCACAGCAGGAAGAAGG - Intergenic
931800436 2:65752886-65752908 TAGTTTTCAGAGAGGGAATGGGG + Intergenic
932630495 2:73338889-73338911 TCGTTTTCAAAGAAGTAATGGGG + Intergenic
933195987 2:79390672-79390694 TGGTTTTCACATATGGAAATAGG + Intronic
933452400 2:82471986-82472008 TGGTTTGCTTAGAAAGAATAAGG - Intergenic
933524654 2:83420355-83420377 TTGATTTCACAGAAGGAGTTAGG - Intergenic
933991199 2:87634997-87635019 GGGTTTTCACAGAAGTGATGTGG - Intergenic
935535583 2:104289921-104289943 TGGTTATTACAGAAGGAAGTGGG - Intergenic
935699422 2:105798496-105798518 TGGTTTAGAGAGAAGAAATAAGG + Intronic
936272443 2:111059547-111059569 TGGACTTAGCAGAAGGAATAGGG - Intronic
936302640 2:111315826-111315848 GGGTTTTCACAGAAGTGATGTGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937262508 2:120595545-120595567 TGCTTTTCACAGAACAAAGAGGG - Intergenic
937668201 2:124511197-124511219 TTGTTTTCTTAGGAGGAATAGGG + Intronic
938644263 2:133315163-133315185 TGCTGTTGACTGAAGGAATAGGG + Intronic
938900020 2:135791784-135791806 TGGTTTTCAAAGAAAGAACCTGG + Intronic
939346619 2:140974476-140974498 TAGTTTTCACAGTATAAATAAGG - Intronic
940670891 2:156666530-156666552 TGGTTTTCACAGGAAGAAATGGG - Intergenic
940684068 2:156824067-156824089 TGATTTTCCAAGAAGAAATAGGG + Intergenic
941052571 2:160751173-160751195 TGGTTCACACCGAAGGAAAAGGG - Intergenic
941374653 2:164712353-164712375 TGATTTTCACAGGTGGAAAAGGG + Intronic
942898122 2:181082952-181082974 ACATTTTAACAGAAGGAATATGG - Intergenic
942982731 2:182101656-182101678 TGGTTTTCACATCTGTAATACGG + Intronic
943454351 2:188085030-188085052 TGTAATTCATAGAAGGAATAAGG - Intergenic
943919447 2:193684670-193684692 TGGTTTTAACAGAAGAATAAAGG - Intergenic
944516334 2:200515309-200515331 TGGTTTTCAGAGAATGAATTGGG - Intronic
944684272 2:202104510-202104532 TGGTTTTCACAGAAGGAATATGG + Intronic
945714631 2:213343005-213343027 TGGTGTACACAGAAGGAAGGAGG + Intronic
946483326 2:220077206-220077228 TGTTTTTTAAAGAAGGAACATGG - Intergenic
946534681 2:220613465-220613487 TTGTTTTTACTAAAGGAATAAGG + Intergenic
946688640 2:222294953-222294975 TGTTTCTCACAGAGGGAAAAAGG + Intronic
947024029 2:225716441-225716463 TTTTTTTCCTAGAAGGAATAAGG - Intergenic
947066225 2:226228547-226228569 TGGTTTTGGCAGAAGCATTACGG - Intergenic
948040659 2:234899048-234899070 TGGTTTTGAGAGAAGGGAGAGGG - Intergenic
948315452 2:237025227-237025249 TGGCTTGAACAGAAGGAATGGGG + Intergenic
948551179 2:238773805-238773827 TGGTTTCCACAGAGGGAAAGTGG - Intergenic
1169599201 20:7237645-7237667 TGATTTTCACAGAAGTAGTATGG + Intergenic
1169603139 20:7285233-7285255 TAGTTTTCACAAAAGAAATCTGG - Intergenic
1170358258 20:15516593-15516615 TGGTTTGAACAGAAGGTAGAGGG + Intronic
1171121685 20:22574019-22574041 ACGTTTTCAGTGAAGGAATAGGG - Intergenic
1171722630 20:28579533-28579555 TGGTTTTCACAACTGGAATACGG - Intergenic
1171755449 20:29103913-29103935 TGGTTTTCCCAACTGGAATACGG + Intergenic
1171787232 20:29478971-29478993 TGGTTTTCACAACTGGAATACGG - Intergenic
1173456286 20:43204511-43204533 TGGTTTTCACATCTGAAATATGG - Intergenic
1173964496 20:47101755-47101777 TGGATGTCAGAGAAGTAATAAGG + Intronic
1174554032 20:51381333-51381355 TGGGTGTCAGAGAAGGAAGAGGG + Intergenic
1175208560 20:57330450-57330472 TGGTTTTCTCAGAATTAACAAGG + Intronic
1176944597 21:14963877-14963899 TGTTTTTAACAGAAGCAAAATGG - Exonic
1177300633 21:19240721-19240743 TGGTTTTCTGGGAAGTAATATGG + Intergenic
1178340630 21:31783158-31783180 ATGTTTTCACACAAGGAAGAGGG - Intergenic
1178668091 21:34566408-34566430 TTGTTTTCAAGGAAGGAAAATGG - Intronic
1180296187 22:10938211-10938233 TGGTTTTCCCAACTGGAATACGG - Intergenic
1180412485 22:12627793-12627815 TGGTTTTCCCAACTGGAATAAGG + Intergenic
1182052083 22:27321057-27321079 TGGTATTCAGAGCAGGAATTTGG + Intergenic
1182878501 22:33712886-33712908 TTGTACTCACAGAAGGTATATGG + Intronic
1183226251 22:36551886-36551908 AGGTTCACACAGCAGGAATATGG - Intergenic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
951708927 3:25570361-25570383 TGGATTTCACAGATGGATTGGGG - Intronic
952071624 3:29643905-29643927 AGGTTTTCAGAGAAAGAAAATGG - Intronic
952729900 3:36627630-36627652 TGGATTTGACAGAAGGCATAAGG + Intergenic
952995007 3:38871310-38871332 TGGCTTTCATATAAGGAATTAGG + Intronic
953098130 3:39798920-39798942 TGGTGTTCTCAGGAGGAACAGGG - Intergenic
953570385 3:44066910-44066932 TGGTTTTCTCAGAGGGAAGGAGG - Intergenic
955194919 3:56796357-56796379 TGGTTTACACAGAAGGCTTGTGG + Intronic
956177909 3:66490822-66490844 TGATTTTCACAGATAGAAGATGG + Intronic
956756342 3:72391517-72391539 TGGGTTTTACAGAAGAAGTATGG - Intronic
957935654 3:86938379-86938401 AGCTTTCAACAGAAGGAATAGGG + Exonic
958029072 3:88085268-88085290 TAGTTGTGACAGAAAGAATATGG - Intronic
958754354 3:98233168-98233190 TAGTATTCACTGAAGGAAAAAGG - Intergenic
959402599 3:105921582-105921604 TGGATTTCAGAGAAGCAAAAGGG - Intergenic
959661991 3:108879359-108879381 TGTATTTAACAGAGGGAATAGGG - Intergenic
960019070 3:112929096-112929118 CGGTTTTCACATAAAGCATATGG + Intronic
960863652 3:122179228-122179250 TGGGTTTCACAGAATGAAAAAGG + Intergenic
962426892 3:135278075-135278097 CAGTTTCCACATAAGGAATAGGG + Intergenic
962925319 3:139987942-139987964 TGGTTTTCTCACAGGGAATAAGG + Intronic
963136150 3:141906623-141906645 TGGTTTTCACATACTGAATTTGG - Intronic
963458503 3:145577154-145577176 TAGCTTTCACAGGAGAAATAAGG + Intergenic
964020576 3:152005430-152005452 GGATTTTCACAGAATAAATATGG + Intergenic
964053942 3:152428783-152428805 TGGTTTTCACACAATGAACCAGG - Intronic
964518926 3:157543028-157543050 GGGTTTTCAAAGAAGGGACAAGG + Intergenic
966702388 3:182869459-182869481 CAGTTTTCACAAAAGGAATGTGG - Intronic
967526287 3:190497545-190497567 TAGATATCACAGAAGGAAGATGG - Intergenic
967896389 3:194399438-194399460 TGGCTTTGACAGTAGGAATCAGG - Intergenic
969412625 4:7039380-7039402 TATTTTTGACACAAGGAATAAGG + Intergenic
969528129 4:7714515-7714537 TGGTTCTAACAGATGGAATGAGG - Intronic
970759604 4:19468940-19468962 TGGTTGTCACAAATGGAATGGGG - Intergenic
972168286 4:36313743-36313765 TGGTTTACACAGAGGATATAAGG - Intronic
972185633 4:36524459-36524481 TGGTTTATACAGAAGAAACAGGG - Intergenic
973686601 4:53376855-53376877 TGGCTATCACAGAGTGAATATGG - Intergenic
975047121 4:69819320-69819342 TGGTTTTCACACATGAAATAAGG - Intronic
977321722 4:95524566-95524588 AGGTTCTCACTGCAGGAATATGG - Intronic
978016997 4:103756734-103756756 TGGTTGTTACAGAAGAAACAGGG - Intergenic
978421339 4:108536401-108536423 TGTTCATGACAGAAGGAATAAGG - Intergenic
982057441 4:151566557-151566579 TGGTTTTCACAAAAGCAATTAGG + Intronic
982906168 4:161075909-161075931 TGCTTTTCACAAATGTAATAAGG - Intergenic
983076002 4:163328267-163328289 TGGTTATCACATAAGTATTAGGG - Intronic
984774859 4:183472687-183472709 TGGGATTCAAAGAAGGAAGAGGG - Intergenic
985426380 4:189835269-189835291 TGTTTTTCACTGGAGGAATATGG - Intergenic
985439536 4:189970471-189970493 TGGTTTTCACAACTGGGATACGG + Intergenic
988385022 5:30551846-30551868 TGGTTTACAGAGAAGGAAAGTGG + Intergenic
989369547 5:40691856-40691878 TGGGGTTCACAGAAGCAATTCGG - Exonic
990019774 5:51111024-51111046 AGGTTTTCAGAGAATGAATTGGG - Intergenic
990191437 5:53264372-53264394 TGGTCTTCACACAGGGAAAAGGG + Intergenic
992114237 5:73523959-73523981 TTGTTTTCACAAATGTAATATGG - Intergenic
992991355 5:82286924-82286946 TGGTTTTCAGATTAGTAATAAGG + Intronic
994818911 5:104622998-104623020 TGGTTGGCACAGAAGGAGTGTGG + Intergenic
995352397 5:111194517-111194539 TCGTTTTCCCAGAAAAAATAAGG - Intergenic
996507443 5:124284119-124284141 TGGTTTTCATAAAAGTAAAATGG - Intergenic
996546526 5:124684731-124684753 TGGTTTTAAAAGAAGGGAAAAGG - Intronic
998358152 5:141558950-141558972 TAGTTTTCTCTGAAGAAATAGGG + Intronic
1000681861 5:164194946-164194968 CGGATTTCACAGAATAAATAGGG - Intergenic
1002113215 5:176935528-176935550 TAGGTTTCATAGAAGTAATAAGG - Intronic
1003741099 6:8940806-8940828 TGGTTTGAACAGAAGTAAAATGG - Intergenic
1004941869 6:20567595-20567617 ATGTCTTCATAGAAGGAATATGG + Intronic
1005125184 6:22438822-22438844 AGTTTTTCACAGAAGGGATGAGG - Intergenic
1006212513 6:32409010-32409032 TGCTTTTCACAAAAGGAGTCAGG - Intergenic
1006508543 6:34507381-34507403 TGGTTTTAGCAGGAGGAATGGGG + Intronic
1006645616 6:35512458-35512480 GGGTTTCCAGGGAAGGAATAGGG - Intronic
1006727193 6:36208044-36208066 TGGTTTTCTCACCTGGAATATGG + Intronic
1009952884 6:70416874-70416896 TAGGTTTTTCAGAAGGAATAAGG + Intronic
1010760553 6:79717595-79717617 AGATTTTCACAGAAGGAAAACGG + Intergenic
1011457935 6:87572189-87572211 TAGTTTTCACAGCTGAAATACGG + Intronic
1013602631 6:111719480-111719502 TGGTTGGCACAGAAGAACTAGGG - Intronic
1014256444 6:119164384-119164406 TGTTTTTCACAGAATGCAAAGGG - Intergenic
1014452187 6:121594297-121594319 TGGTTGTCACAAATGGAAAAGGG - Intergenic
1015118341 6:129674314-129674336 TGGTTTTCAAGGAAGGAAGGAGG - Intronic
1015748419 6:136535585-136535607 TGGCTTTCACTGAAGGAAAATGG - Intronic
1015885945 6:137918828-137918850 TGGTTGTCACAGAATGGAGATGG - Intergenic
1016596145 6:145803645-145803667 AGGGTATCACAGAAGGAAAATGG + Intronic
1017557745 6:155590385-155590407 TGGTTTTGCCAGATGGAATATGG + Intergenic
1018449663 6:163895700-163895722 TGCTTTCCACAAAAGGAAGATGG + Intergenic
1019720193 7:2564955-2564977 TGGTTGTAACAGAAGAAATGGGG - Intronic
1019844755 7:3487023-3487045 TGGTTTTGACAGAAGCCATCCGG - Intronic
1020447227 7:8281975-8281997 TGTTATTCAAAGAAGCAATAAGG + Intergenic
1020617755 7:10480716-10480738 TGGAGTTCAATGAAGGAATATGG + Intergenic
1021085248 7:16415187-16415209 TGATTTTGACAAAAGGAAAATGG + Intronic
1021159501 7:17254563-17254585 TGGTTTTCAGGGAAGGAAGAAGG + Intergenic
1022074317 7:26952469-26952491 TTGTTTTCACAGAAGGTCTTAGG - Intronic
1022574093 7:31481090-31481112 TGGTGTAGACAGAAGGAATGGGG - Intergenic
1022612520 7:31891132-31891154 AGATTGTCACAGAAGGAAAAGGG + Intronic
1023564632 7:41511730-41511752 TGGTTTTCACAGACAAAATTAGG + Intergenic
1023677446 7:42645107-42645129 TGGTTTTCACTGAGGCAAGAGGG - Intergenic
1024033420 7:45484510-45484532 TGGCTTTCACAAAAAGAATTAGG + Intergenic
1025284649 7:57651825-57651847 TGTGTTTCACAGGAGGCATACGG + Intergenic
1026019586 7:66697071-66697093 TGGTTGACACAGAGGGAAGATGG - Intronic
1027302365 7:76853368-76853390 TAGTATTCAAAGAAGCAATAGGG - Intergenic
1027482770 7:78719143-78719165 TGGTTCACATAGAAGGTATAGGG - Intronic
1027583774 7:80031411-80031433 TGATTTTCACAAATGTAATATGG + Intergenic
1027847823 7:83406049-83406071 TGGTTTTCACAGAATGATGTAGG - Exonic
1028068458 7:86418321-86418343 TGGTGTTCACAGAATGAAATAGG - Intergenic
1028713368 7:93936489-93936511 AGGTTTTCAATGATGGAATACGG + Intergenic
1028876082 7:95824834-95824856 CGGTTTACACAGAAGGAATTCGG + Intronic
1028893237 7:96012131-96012153 AAGTTTTGACAGAAGGTATATGG + Intronic
1029731437 7:102440850-102440872 TTGTTTTCACATAAGGAAACAGG - Intronic
1031268908 7:119619816-119619838 TAGTTTTCACAGAGGGAAAAGGG - Intergenic
1032351198 7:131165496-131165518 TGTTTTACACAGAAGGTGTAGGG + Intronic
1032643553 7:133796282-133796304 TGGTATTCACTCAAGGAAAAAGG - Intronic
1032728137 7:134611288-134611310 TGGATTTAACAGAGGGAAGAAGG - Intergenic
1033577586 7:142701121-142701143 TGGTTTTCACTGAACGAATGAGG - Intergenic
1033636705 7:143218623-143218645 TTGTGTTCACAGAAGGAGTTTGG - Intergenic
1034818068 7:154191504-154191526 TGGTCTGCACAGAGGGAAAAGGG - Intronic
1034985177 7:155508488-155508510 AGGTTTCCACATAAGGAATCAGG - Intronic
1035061659 7:156074033-156074055 TTGATTTCTCAGTAGGAATATGG - Intergenic
1035217930 7:157383816-157383838 TGGGTTTCAAAGATGGAACATGG + Intronic
1035947430 8:3980940-3980962 TGGTTTTCCCATAAAGAGTAGGG + Intronic
1036479338 8:9124360-9124382 TGGTTTTTGCAGCGGGAATAAGG + Intergenic
1036621382 8:10426297-10426319 TGGATTCTACAGAAGGAATTCGG + Intronic
1037014151 8:13881705-13881727 TGGTTTTCACAGGAAGAAACAGG + Intergenic
1038901508 8:31849554-31849576 TGGCTTTCTCATAAGAAATAGGG - Intronic
1039946858 8:42137380-42137402 TGTTTTTAACAGGATGAATATGG - Intergenic
1041239554 8:55837907-55837929 TAGTTTTCACATAATGAAAATGG - Intergenic
1043564303 8:81531365-81531387 TGGTTTTCCCTGAAGTAGTATGG + Exonic
1043733322 8:83713059-83713081 TGGTTATAATAGAAGGAACATGG - Intergenic
1043826793 8:84938776-84938798 TGCTCTTCCCAGAAGGAATCTGG - Intergenic
1044756967 8:95473628-95473650 TGGTATTCACAGAAGCTATGTGG + Intergenic
1044890448 8:96829456-96829478 TGGAATTCACAGAATGAAGATGG + Intronic
1046320791 8:112571537-112571559 TGGGTTTCACAGAAGAAACCTGG - Intronic
1047483298 8:125305281-125305303 AGGTTTTCACAGTAGTAAAATGG - Intronic
1047921198 8:129636194-129636216 AGGATGTCACAGAAGGACTAGGG + Intergenic
1051687686 9:19675574-19675596 TTATTTTCCCAGAAGGATTATGG + Intronic
1051922831 9:22287763-22287785 AGGTTTTCATACAAGGAATTCGG - Intergenic
1053417677 9:37956809-37956831 TGTTTTTCAGAGAAGGAAACAGG - Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053747904 9:41219564-41219586 TCGTTTTCACAACTGGAATACGG + Intergenic
1053926109 9:43059564-43059586 CGGTTTTTACAGAAGTAAAATGG - Intergenic
1054338480 9:63830951-63830973 TTGTTTTCACAACTGGAATACGG - Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054479382 9:65645807-65645829 TCGTTTTCACAACTGGAATACGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055514893 9:77024044-77024066 TGGTTTTCACAGTAAGGAGAAGG + Intergenic
1056308682 9:85318354-85318376 TGTTTTTCACAGAGAGTATAGGG + Intergenic
1057601744 9:96464156-96464178 TGGGAATCACAGGAGGAATAAGG + Intronic
1058417465 9:104803515-104803537 TGGTTCTCATATAAGTAATAGGG - Intronic
1058717906 9:107738880-107738902 TGGTTGTCACACTAGGAGTAAGG + Intergenic
1059674315 9:116523393-116523415 TGGTTTACTCAGGAGGATTAGGG - Intronic
1060851973 9:126885455-126885477 TGGTTTTCACATTAGGAAAATGG - Exonic
1202784038 9_KI270718v1_random:30335-30357 TCGTTTTCACAACTGGAATACGG + Intergenic
1202803039 9_KI270720v1_random:19245-19267 TGGTTTTCCCAACTGGAATACGG - Intergenic
1203447833 Un_GL000219v1:76458-76480 TGGTTTTCACAACTGGAATACGG - Intergenic
1186658812 X:11646496-11646518 TGGTTATCACAGAAGAAAACAGG + Intronic
1186763273 X:12745390-12745412 TTTCTTTCACAGAAGGAAGAAGG - Intergenic
1187492591 X:19765944-19765966 TAGTATTCACAGAAGGCAAAAGG - Intronic
1187511831 X:19926723-19926745 TGATTTTCACTCAAGGAAAATGG - Intronic
1187647519 X:21364397-21364419 TGTACTTAACAGAAGGAATAGGG + Intergenic
1188170262 X:26915952-26915974 TGGTTTTTACAGAATGAAACAGG + Intergenic
1188612814 X:32120254-32120276 TGGTTTTCACAGCATGATCAAGG + Intronic
1189732369 X:44034525-44034547 TGTTTTACACTGAAGGAATCTGG + Intergenic
1194291834 X:92083007-92083029 TGGTTTTGACAGAATAAACATGG - Intronic
1197687873 X:129461724-129461746 TGGTTTTCTTAGAAAGAAAATGG + Intronic
1199087109 X:143640091-143640113 TCGTTTTCACAGGGGGATTAGGG + Intergenic
1199917423 X:152359062-152359084 TGGTTCTCACAGAATGAGTTAGG + Intronic
1200260001 X:154609421-154609443 TGGTTTTGTCAGAAAGAAAAGGG - Intergenic
1200609350 Y:5307579-5307601 TGGTTTTGACAGAATAAACATGG - Intronic
1200693519 Y:6333623-6333645 TGATTTACACAAAAGAAATAAGG + Intergenic
1201041756 Y:9841102-9841124 TGATTTACACAAAAGAAATAAGG - Intergenic
1201864298 Y:18632934-18632956 TGGCTTGCACAGAAGGCTTATGG - Intergenic
1201869024 Y:18687444-18687466 TGGCTTGCACAGAAGGCTTATGG + Intergenic