ID: 944685896

View in Genome Browser
Species Human (GRCh38)
Location 2:202117493-202117515
Sequence TTGTCCTCCCTTACATCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944685896_944685897 -8 Left 944685896 2:202117493-202117515 CCGAGAGATGTAAGGGAGGACAA 0: 1
1: 0
2: 1
3: 22
4: 199
Right 944685897 2:202117508-202117530 GAGGACAATTAATTTTGATAAGG 0: 1
1: 0
2: 0
3: 21
4: 233
944685896_944685900 20 Left 944685896 2:202117493-202117515 CCGAGAGATGTAAGGGAGGACAA 0: 1
1: 0
2: 1
3: 22
4: 199
Right 944685900 2:202117536-202117558 TGAGGAAGAAGAAAAAACTCTGG 0: 1
1: 1
2: 11
3: 85
4: 916
944685896_944685898 2 Left 944685896 2:202117493-202117515 CCGAGAGATGTAAGGGAGGACAA 0: 1
1: 0
2: 1
3: 22
4: 199
Right 944685898 2:202117518-202117540 AATTTTGATAAGGCCATGTGAGG 0: 1
1: 0
2: 1
3: 27
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944685896 Original CRISPR TTGTCCTCCCTTACATCTCT CGG (reversed) Intronic
902166469 1:14575878-14575900 TTGTCCACCATTATATCTCTAGG + Intergenic
902740783 1:18436590-18436612 TTCTCCACCCACACATCTCTCGG + Intergenic
902856757 1:19211907-19211929 CTGTCCTCCCTTCCCTCTCCAGG + Intergenic
903651440 1:24924893-24924915 TTTTCCTCCCTTCCTTTTCTTGG + Intronic
904345554 1:29866469-29866491 TTATCCTCCCTCACTTCCCTGGG + Intergenic
905446171 1:38029761-38029783 TTTTCCTGCCTCTCATCTCTGGG + Intergenic
906953161 1:50350522-50350544 TTGTCCTCACTTAGGTCTGTGGG - Intergenic
908165598 1:61454655-61454677 TTTTCCTTCCTTACATATGTAGG - Intronic
908589722 1:65617375-65617397 CTGCCCTCCCCTACATCTTTTGG - Intronic
911327401 1:96484271-96484293 TTGACCCCACTTACTTCTCTAGG + Intergenic
912002822 1:104856344-104856366 TTGTCCTCACTTAGGTCTGTGGG + Intergenic
912161935 1:106996101-106996123 TTGGCCCCCCTAACCTCTCTGGG + Intergenic
913068970 1:115283175-115283197 TTGTCCTCTATTCCAGCTCTGGG + Intergenic
914951352 1:152117505-152117527 TTGGCCTCCCTTCCTGCTCTTGG + Intergenic
915331633 1:155116443-155116465 TTCTCCTGCCCTACCTCTCTGGG + Intergenic
918095101 1:181327920-181327942 TTGGCCTCACTGACATCTATGGG + Intergenic
919383509 1:196889102-196889124 TTATCCTCCATTACATTTGTTGG - Intronic
920767144 1:208844130-208844152 TTATCCTCCCAAACTTCTCTTGG - Intergenic
923951171 1:238956113-238956135 TTTTTCTTCCTTTCATCTCTTGG + Intergenic
924002703 1:239571501-239571523 ATATCCTCCCTTATACCTCTGGG + Intronic
924172834 1:241358829-241358851 TCCTCCTCCTTTGCATCTCTGGG + Intergenic
924270871 1:242331312-242331334 TTGCCCTCCATTACATCTTTAGG + Intronic
924355258 1:243166665-243166687 TTGGCCTTCCTGACTTCTCTAGG - Intronic
1065722971 10:28643865-28643887 ATGACCTCTCTTCCATCTCTGGG - Intergenic
1065799815 10:29341916-29341938 TTTTCCTCCCTCACCTCCCTTGG - Intergenic
1066349777 10:34626474-34626496 TTGTCTTCCTTTCCATCCCTTGG - Intronic
1067815825 10:49476153-49476175 TTTTCCTCCCTCACTTCTCTTGG + Intronic
1068097961 10:52515700-52515722 TTGAGCACCCTGACATCTCTAGG + Intergenic
1068587588 10:58816610-58816632 TTGTCCTCCCTCACCTCTTTGGG + Intronic
1068762374 10:60727032-60727054 ATGTCTTACCTCACATCTCTAGG - Intronic
1072301355 10:94065299-94065321 TTTTCCTCCCTTTGACCTCTCGG + Intronic
1072882537 10:99242159-99242181 TTGTCATCCCTTGCTTCTCCTGG - Intergenic
1073674487 10:105630277-105630299 CTGTCCTCCCTTAAACCACTGGG + Intergenic
1074096455 10:110317857-110317879 TTGTCCTCCCTTAGGTCCTTGGG - Intergenic
1074222381 10:111450713-111450735 TTGCCCTCCATCACATCACTTGG - Intergenic
1074386352 10:113019534-113019556 TGGTCACCCCTTTCATCTCTTGG + Intronic
1075305998 10:121367666-121367688 TTTTCCACCCTTACTCCTCTAGG - Intergenic
1077860091 11:6170264-6170286 TTGTCCTTCCTGGCATCCCTGGG - Exonic
1079623195 11:22580958-22580980 CAGTCCTACCTTACAACTCTTGG - Intergenic
1079766915 11:24405924-24405946 CTGTCCTCACTTAGGTCTCTGGG - Intergenic
1080423976 11:32139239-32139261 TTGTACTCCTTCACATGTCTAGG - Intergenic
1081072145 11:38624388-38624410 TTGACCCCACTTACAACTCTAGG + Intergenic
1081421230 11:42876174-42876196 TTGTCCTCACTTACATGAATAGG - Intergenic
1083016482 11:59459359-59459381 TTGAGCTTCCTTACTTCTCTTGG - Intergenic
1084444472 11:69195764-69195786 CTGTGGTCCCTTCCATCTCTGGG + Intergenic
1087157029 11:94914991-94915013 TTTTCCTCCCTTACTTTTCTTGG + Intergenic
1087258019 11:95978930-95978952 TTGTCTTCCCTTTCTTCTTTAGG + Exonic
1088042933 11:105410529-105410551 TGCTCCTCACCTACATCTCTGGG - Intergenic
1088379028 11:109173081-109173103 TTGTCCTCCCTTCTATCTCCTGG + Intergenic
1088639472 11:111857564-111857586 TTCTCCTCCCATATATCGCTGGG - Intronic
1088684113 11:112270799-112270821 TTGTGCTCCCCTCCAGCTCTGGG + Intergenic
1089041117 11:115451145-115451167 TTTTCCTCCCTTCTATCTCTGGG - Intronic
1089761744 11:120731387-120731409 TTGAACTCCCTTGCATCCCTGGG + Intronic
1092472113 12:8789474-8789496 TTGTCCTCGCTTACATGAATAGG - Intergenic
1096875887 12:54630149-54630171 TTTTCCTCCCCTACAGCTCATGG - Intergenic
1096921426 12:55090745-55090767 TTGTCCTCACTGAGATCACTAGG - Intergenic
1098134787 12:67390549-67390571 TCCTGCTCCTTTACATCTCTAGG - Intergenic
1098918008 12:76277017-76277039 ATGTCCTCCCTTGGATGTCTGGG + Intergenic
1100321139 12:93494019-93494041 ATGTCCTTCCTTCCATCTCAGGG - Intronic
1100321535 12:93497979-93498001 ATGTCCTTCCTTCCATCTCAGGG + Intronic
1100993273 12:100273677-100273699 TCTTCCTCCCTTACATATCTTGG + Intronic
1101199587 12:102420767-102420789 TTCTCCTCCCTTATCTCTCCTGG + Intronic
1101578247 12:106017853-106017875 TTTTTCTCCCTTACTTTTCTTGG + Intergenic
1102542529 12:113632730-113632752 TTCACATTCCTTACATCTCTTGG + Intergenic
1108802462 13:54116316-54116338 TTGTTCTCCATTGCATCTCCTGG - Intergenic
1113006074 13:105703568-105703590 TTGTCCTTACATACATATCTTGG + Intergenic
1113204091 13:107896103-107896125 TTGTCCTCACTTACATGAATAGG + Intergenic
1115372753 14:32637022-32637044 TTTACCTCCCTAACATCTCTTGG - Intronic
1117222989 14:53625134-53625156 TTTTCCTCTCATACATCTTTTGG - Intergenic
1128136616 15:65268354-65268376 GTGGCCTCACTTACATTTCTGGG - Intronic
1128396354 15:67230214-67230236 TTTTTCTGTCTTACATCTCTTGG - Intronic
1128793832 15:70450755-70450777 TCGTCCCACCTTCCATCTCTGGG - Intergenic
1130201129 15:81827874-81827896 CTGTCATCCATTACATATCTTGG + Intergenic
1130876123 15:88016304-88016326 TTGGCTTCCCATGCATCTCTGGG - Intronic
1130970351 15:88727402-88727424 TTTGCCTCCCTACCATCTCTAGG - Intergenic
1134092869 16:11400848-11400870 TTGTCCTCCCTTTCATAGATGGG + Intronic
1135163255 16:20116051-20116073 TTCTCCTCCCTTCCAACTCTGGG - Intergenic
1135649365 16:24192572-24192594 TGGACCTCCCTTTCCTCTCTTGG + Intronic
1137925814 16:52540669-52540691 TTCTCTTCCTGTACATCTCTTGG - Intronic
1138118932 16:54382554-54382576 TTGTCTTCTCTCTCATCTCTTGG - Intergenic
1138202021 16:55096218-55096240 TATTCCTCCCTGACATCGCTGGG - Intergenic
1139415073 16:66801475-66801497 TTGTCCTGCCTTACCGCGCTTGG - Exonic
1141373241 16:83506374-83506396 CTCTCCTCCCTTTCATCTGTTGG - Intronic
1141532736 16:84658008-84658030 TTGACTTTCCTTACCTCTCTGGG + Intronic
1142874237 17:2841863-2841885 TTTTCCTCCCTCCCTTCTCTCGG + Intronic
1143408339 17:6692964-6692986 TTCTCCACCCTTCCATCCCTGGG - Intronic
1146960740 17:36974748-36974770 TTTTGCTCCCTTACATTTATTGG + Intronic
1147241646 17:39094541-39094563 GTGTCCCCCATTACATCGCTTGG + Intronic
1149422584 17:56525392-56525414 GATTCCTCCCTTACATCTTTGGG + Intergenic
1149560700 17:57605970-57605992 CTGTCCTCCTTTTCATTTCTGGG - Intronic
1151503822 17:74512917-74512939 CTGTCCTCCCTGACAGCTCAGGG - Intergenic
1153207660 18:2720193-2720215 TTTTCCTACTTTCCATCTCTTGG + Intronic
1154938395 18:21085615-21085637 CTGTTCTCCCTTACATCTTTTGG - Intronic
1156847049 18:41678057-41678079 GTGTCCTCCTTTCTATCTCTTGG - Intergenic
1159057219 18:63478006-63478028 TTTTCATCCCCTACATCTCCCGG + Intronic
1159619577 18:70621827-70621849 TTTTCCTCCCTGAGATCTGTGGG - Intergenic
1160279496 18:77474352-77474374 TTTTCCCCTCTTACATGTCTTGG - Intergenic
1163191425 19:15679638-15679660 TTCTCCTCCTTGTCATCTCTTGG + Intronic
1164339625 19:24376949-24376971 TTGCACTCCCATATATCTCTTGG - Intergenic
1168061762 19:53897045-53897067 TTGTCCTCCCTCCCACCTCAGGG - Intronic
926195887 2:10763354-10763376 TTGTCCTCCCTTAGCACTCTAGG + Intronic
929826701 2:45314421-45314443 TTGTCAACCCTTACATTGCTGGG - Intergenic
934681267 2:96285579-96285601 TTGTCATCCCACACATCTCCAGG - Intronic
935831650 2:107006751-107006773 AAGTCCTCCCTTCCATCCCTGGG - Intergenic
940920215 2:159297604-159297626 TTGTCCACCTTTACCTATCTAGG + Intergenic
942871967 2:180745815-180745837 TTTTCCTACCTTAGATCTGTAGG - Intergenic
943432982 2:187827302-187827324 TTTTTCTCCCTTACTTTTCTTGG + Intergenic
944685896 2:202117493-202117515 TTGTCCTCCCTTACATCTCTCGG - Intronic
944715058 2:202369669-202369691 TTGACCTCCCTGACATCCTTTGG - Intergenic
948171678 2:235908494-235908516 GTGTCTCTCCTTACATCTCTAGG + Intronic
948544297 2:238716032-238716054 TTGTCCTTCCTTACCTCCCTGGG - Intergenic
948785579 2:240350742-240350764 GTGTCCTCTCTTACAGCTCCGGG - Intergenic
1170624359 20:18020086-18020108 TTCTCCTCCATGACATCACTTGG - Intronic
1170644163 20:18181804-18181826 TTGTCAGCCCTTATACCTCTCGG + Exonic
1170860431 20:20098211-20098233 TATTCCTCCCTTAAATCTCAAGG + Intronic
1172777526 20:37416163-37416185 GTGTCCTTCCTTCCCTCTCTGGG + Intergenic
1173211876 20:41040468-41040490 TTCTCCTCCCTTTCCTCTCCTGG - Intronic
1178723945 21:35034849-35034871 TCTTCCTCCTGTACATCTCTCGG - Intronic
1179330370 21:40395141-40395163 TCTTCCTCCCTTTCCTCTCTTGG + Intronic
1183119603 22:35720166-35720188 TTGTCCTCACTTAGATCCATGGG + Intronic
1183801212 22:40166140-40166162 TCCTTCTCCCTTACATCTCTGGG + Intronic
1184016790 22:41792224-41792246 TGGTCCTCCTTGACACCTCTGGG + Intronic
949121038 3:384482-384504 TTTTCCTCCTTTACATATCTCGG + Intronic
953628340 3:44589393-44589415 TTGCCCTACTTGACATCTCTTGG + Intronic
956347081 3:68292220-68292242 TTGTCCTTCCTTAAATCTCTGGG - Intronic
956582166 3:70826193-70826215 TTTCTCTCCCTTTCATCTCTTGG + Intergenic
956941789 3:74170515-74170537 CTGTGCTCCCCTACATTTCTTGG - Intergenic
958867404 3:99517170-99517192 TTGTCCTACTTTTCCTCTCTTGG - Intergenic
959544834 3:107582624-107582646 TTATCCTACCTTAAATCTGTTGG + Intronic
960878153 3:122317037-122317059 TTCTACTCCCATACTTCTCTAGG - Intergenic
961181476 3:124881499-124881521 TTCTCCTTCCCTACATCCCTGGG - Intronic
961449745 3:126997308-126997330 TTGTTCTGCCTTAACTCTCTGGG + Intronic
961456105 3:127024707-127024729 GTGTCCTCCCTTGCATATATAGG - Intronic
962678476 3:137773958-137773980 TTGTCCTTGCTTAGATCTATAGG - Intergenic
963021077 3:140873622-140873644 TTGTCCTCACTTACATGAATAGG - Intergenic
963231621 3:142914207-142914229 TAGCCCTCCCTTGTATCTCTGGG + Intergenic
965221040 3:165925654-165925676 TTCTTCCCCCTAACATCTCTAGG - Intergenic
965906253 3:173710247-173710269 TTGTCCTTCCTTAATTCTATGGG + Intronic
968611395 4:1558766-1558788 TTCTCCTTCCTTACAGCCCTAGG + Intergenic
969704885 4:8786244-8786266 ATGTCCTCCCTCACATCCCTGGG + Intergenic
970416526 4:15863093-15863115 TTTTCCTCCCTTCCATTACTTGG - Intergenic
972371675 4:38430069-38430091 TTGTTCTTCCTAACATCTATTGG - Intergenic
973942750 4:55926859-55926881 TTCTCCTCATTTACAGCTCTTGG - Intergenic
975655356 4:76635915-76635937 TTGTCCTCTCTGAAATCTGTGGG + Intronic
976202147 4:82589618-82589640 TTAAGCTCCCTTCCATCTCTTGG + Intergenic
976848953 4:89523107-89523129 TTATCTTACCTTACATCCCTTGG + Intergenic
977251174 4:94691452-94691474 GAGTCCTCCCTGACTTCTCTAGG + Intergenic
979246540 4:118512967-118512989 TTGGCCTTCCTGACTTCTCTAGG + Intergenic
981729850 4:147885708-147885730 TGGTTCTCCCTCAGATCTCTTGG + Intronic
982752587 4:159179800-159179822 ATCTCCTCCCTTACAACTCCTGG + Intronic
983835129 4:172375967-172375989 TTGTCCTCACTTACATGAATAGG + Intronic
984349568 4:178572415-178572437 ATGTCTTCCCTTATTTCTCTAGG - Intergenic
985095114 4:186405562-186405584 TTTTCCTACCTTAAATCTCTTGG - Intergenic
986084329 5:4428577-4428599 GTGTCATTCCCTACATCTCTTGG - Intergenic
986558397 5:9035305-9035327 TTGTGCTCTCTTACTGCTCTTGG - Exonic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
991068332 5:62448399-62448421 TTGTCCTCCCTTACTTTCCATGG - Intronic
991433654 5:66573716-66573738 TTGTCCTCCCTTCCATGGCAAGG + Intergenic
992348254 5:75902451-75902473 CTGTCATCCCTTTCACCTCTAGG + Intergenic
993055808 5:82977999-82978021 TTTTTCTCCCTTACTTTTCTTGG + Intergenic
993373683 5:87122646-87122668 TTGTTCTTCGTTACATCTCTTGG + Intergenic
994001801 5:94790270-94790292 TTGGCATCCCTAACCTCTCTGGG - Intronic
994629263 5:102262787-102262809 ATGTCCTTTCTTAAATCTCTGGG + Intronic
996262616 5:121492088-121492110 TCTTCCTCCCTTACAACTCCTGG + Intergenic
997535052 5:134613800-134613822 TTCTCCTCCCTTCCACTTCTGGG + Intronic
998103950 5:139456670-139456692 TTCTCCTCCCTCTCCTCTCTGGG + Intronic
998222251 5:140293908-140293930 TTGTTTTCCCTTAGAACTCTGGG + Intronic
999176822 5:149637779-149637801 TTTCCCTTCCTTAGATCTCTGGG + Intergenic
1004841742 6:19594906-19594928 TTGTCCTGCCTTTTGTCTCTTGG - Intergenic
1007677525 6:43609271-43609293 TTGTTCTCTCCTGCATCTCTAGG + Intronic
1007748461 6:44057350-44057372 CTCTCCTCCCTAACATCTCCAGG - Intergenic
1010516615 6:76780740-76780762 TTGTACTTGCTTACATCTCCAGG + Intergenic
1010543107 6:77116688-77116710 TTGTGCTCCCTTAGTTCTGTGGG - Intergenic
1010804174 6:80215414-80215436 TTGTCCTGCCTGACAGCCCTTGG + Intronic
1011454350 6:87531248-87531270 TTGTTTTCCCTGACCTCTCTCGG - Intronic
1011917096 6:92520542-92520564 TTGGCCTCAGTTACATGTCTGGG - Intergenic
1013742946 6:113309927-113309949 TTGTCCTCCCTAAAGTTTCTGGG - Intergenic
1014643060 6:123937955-123937977 TTCTCCTCCCTTGCTCCTCTTGG + Intronic
1015890110 6:137962181-137962203 TGCCCCTCCCTTCCATCTCTTGG + Intergenic
1015909468 6:138154157-138154179 TTGTCTTCCCAAATATCTCTAGG + Intergenic
1017602095 6:156094794-156094816 TTGTCCTCCCTCCACTCTCTGGG + Intergenic
1021233201 7:18110482-18110504 TTGTCCTTTGTCACATCTCTGGG - Intronic
1029225369 7:99023256-99023278 GTGTTCTCCCATAGATCTCTGGG - Intergenic
1030694362 7:112568729-112568751 TTGTGCTCCTTTACATCCCTGGG - Intergenic
1032422349 7:131792709-131792731 GTGTCCTTCCTTAGATCTTTGGG + Intergenic
1033549484 7:142433722-142433744 GTGTCCTCACTCACATCTCTAGG - Intergenic
1034997512 7:155587496-155587518 TTTTCCTCCCTTACGGGTCTGGG + Intergenic
1035041677 7:155933417-155933439 TTGTCCTCCCTTAGGCATCTTGG + Intergenic
1035139526 7:156744223-156744245 TATTCCTCCCTTACAACTATGGG + Intronic
1036424946 8:8636294-8636316 TTTTCCTCCATTACTTCTGTAGG + Intergenic
1037347006 8:17911711-17911733 TAGTGTTCCCTTACAGCTCTTGG - Intergenic
1037453999 8:19045687-19045709 TTTTCCTTCCTTCCATTTCTAGG - Intronic
1040422101 8:47250508-47250530 TTGTATTCCCTTGCATCTCTTGG + Intergenic
1041864285 8:62551583-62551605 TTGTCCTCTCTGACCTCTGTGGG - Intronic
1044923027 8:97185811-97185833 CTGTCCTCCCTCACAGCACTTGG - Intergenic
1046056703 8:109086897-109086919 TTGTCCTCTCTTGAATCTGTGGG + Intronic
1047696707 8:127410713-127410735 TTGTCTTCCCTGCCAGCTCTGGG - Intergenic
1047958117 8:129991212-129991234 TTGTTCTCCATTGTATCTCTAGG + Intronic
1051107339 9:13595009-13595031 TTGTCCTCCACTGCATGTCTAGG + Intergenic
1054835099 9:69668699-69668721 TTATCCCTCATTACATCTCTTGG + Intronic
1055394440 9:75858911-75858933 CTGTCTTTCCTGACATCTCTTGG - Intergenic
1057221410 9:93259669-93259691 CTGTCCTCCTTTGCATCTCTGGG - Intronic
1057262437 9:93592632-93592654 TTGTCCGTCCTTTCTTCTCTTGG + Intronic
1057604852 9:96491961-96491983 CTGTCCTCCCTGGCTTCTCTGGG - Intronic
1057846253 9:98527460-98527482 TTTTCCTCTCTTAATTCTCTTGG - Intronic
1058797890 9:108516114-108516136 TTCTCCTCCCTTCCCTTTCTGGG + Intergenic
1187632239 X:21186396-21186418 TTGCTCTCCCTCACATTTCTGGG + Intergenic
1188619980 X:32208532-32208554 CAGTCCTCCATTACACCTCTGGG - Intronic
1189102650 X:38207303-38207325 TTCTCCTCTCTCCCATCTCTGGG - Intronic
1189130546 X:38493828-38493850 TCTTCCTCCCTTACTCCTCTGGG + Intronic
1189144511 X:38642151-38642173 GTGTGCTCCCTTTAATCTCTGGG - Intronic
1189862484 X:45288036-45288058 CTGTCTTCCCCTACATCTCAAGG - Intergenic
1192993047 X:76483030-76483052 TTGTCCTCTCTGACTTCTTTTGG + Intergenic
1193349417 X:80442876-80442898 TTTTCCTTCTTTACATCTTTTGG - Exonic
1196022630 X:111006417-111006439 TATTCCTCCTTTACATTTCTAGG - Intronic
1197883549 X:131193949-131193971 TTGTGGTCCCTTCCATCTCCAGG + Intergenic
1198507742 X:137318164-137318186 TGGTCCTACCTTCCAACTCTGGG + Intergenic
1198520571 X:137448501-137448523 TTGTTTTCCCTAACATTTCTTGG + Intergenic
1201468618 Y:14311437-14311459 TTGTCCTCACTTACATGAATAGG - Intergenic
1202272296 Y:23083719-23083741 TTGTCCTCACTTACATGAATAGG + Intergenic
1202293730 Y:23336963-23336985 TTGTCCTCACTTACATGAATAGG - Intergenic
1202425293 Y:24717463-24717485 TTGTCCTCACTTACATGAATAGG + Intergenic
1202445496 Y:24952622-24952644 TTGTCCTCACTTACATGAATAGG - Intergenic