ID: 944688420

View in Genome Browser
Species Human (GRCh38)
Location 2:202137918-202137940
Sequence GGCAAACGCCAAAGTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944688420_944688429 28 Left 944688420 2:202137918-202137940 CCATCCCCACTTTGGCGTTTGCC 0: 1
1: 0
2: 0
3: 14
4: 151
Right 944688429 2:202137969-202137991 TCTTGCCCCTCCACATTATGAGG 0: 1
1: 0
2: 1
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944688420 Original CRISPR GGCAAACGCCAAAGTGGGGA TGG (reversed) Intronic
902377832 1:16038395-16038417 GGCACAGGCCAATGTGGGGAGGG + Intergenic
902382980 1:16061311-16061333 GGCACAGGCCAATGTGGGGAGGG + Intronic
902932085 1:19738621-19738643 GGCAAAGGCCAAAGTGGCATTGG - Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
904741203 1:32677411-32677433 TGCATACGGCAAGGTGGGGAGGG - Intronic
910884640 1:91951759-91951781 GTGAGACTCCAAAGTGGGGAAGG + Intronic
912492519 1:110070140-110070162 GGCAAAGGCCAGTGTGGGGCGGG - Intronic
913674151 1:121125718-121125740 CCCAAATGCCAAAGTAGGGAGGG - Intergenic
914025935 1:143913039-143913061 CCCAAATGCCAAAGTAGGGAGGG - Intergenic
914664372 1:149820759-149820781 CCCAAATGCCAAAGTAGGGAGGG - Intergenic
914671391 1:149873076-149873098 CCCAAATGCCAAAGTAGGGAGGG + Intronic
915362973 1:155296839-155296861 GGCCAACGCCTGAGTGGGGTGGG - Intronic
919417796 1:197332919-197332941 GGGAAAAGCCAAAGTTGAGAAGG + Intronic
922714294 1:227858847-227858869 GACAAAGACCACAGTGGGGAGGG - Intergenic
923207875 1:231776178-231776200 GGCTAACGGCAAAGTGAGGGAGG + Intronic
1064464716 10:15567665-15567687 GGCAAAAGAGAAAGTGGGAAGGG + Intronic
1064827426 10:19420835-19420857 GGGCAACTCCAAAGTGGGGAAGG + Intronic
1064956450 10:20916257-20916279 GAGAAACTGCAAAGTGGGGAAGG + Intronic
1066961387 10:42230787-42230809 GGCCAAGGCCAAGGTGGGGCAGG + Intergenic
1067944857 10:50683100-50683122 GGCAAAGGCCAAAGGGGCCAAGG + Intergenic
1069082787 10:64105951-64105973 GGCACACATCAGAGTGGGGAAGG + Intergenic
1071633267 10:87232192-87232214 GGCAAAGGCCAAAGGGGCCAAGG + Intronic
1071646716 10:87364410-87364432 GGCAAAGGCCAAAGGGGCCAAGG + Intronic
1074348142 10:112708814-112708836 GGCAAACGGCGAAGTGGGAAAGG - Intronic
1077101780 11:825697-825719 GCCAAACGCCCAAGTGGAGCAGG - Intergenic
1078338238 11:10480820-10480842 GGCATAGCCCAGAGTGGGGAGGG - Intronic
1078902230 11:15652072-15652094 GGCAAAAACGAAACTGGGGAAGG + Intergenic
1079138709 11:17793209-17793231 GGCAAACAGCAAAGAGGAGATGG + Intronic
1080040539 11:27754970-27754992 GGCCAACATCCAAGTGGGGAGGG + Intergenic
1082229869 11:49750644-49750666 GGCCAACTCCACTGTGGGGAGGG + Intergenic
1083730291 11:64649085-64649107 GGCAGATGGCAAAGTGGAGAAGG - Intronic
1086261700 11:84947588-84947610 GGCAGACTCAAAAGTGGGTAAGG - Intronic
1087777342 11:102268587-102268609 GGCAAACGAGAATGTGGGGGAGG - Intergenic
1089674758 11:120082232-120082254 GGCAAATGCCGAAGTGAGGCAGG - Intergenic
1091633533 12:2180276-2180298 GGCAAAGGCCAAAGGGGTGGTGG + Intronic
1092778955 12:11967705-11967727 GAAAAATGCAAAAGTGGGGAAGG + Intergenic
1095359027 12:41313309-41313331 GGCAAAAGGAAAACTGGGGATGG - Intronic
1095948076 12:47765230-47765252 GGGAAACAGAAAAGTGGGGAAGG + Intronic
1096590948 12:52659004-52659026 GGCAAGCACAAAAGAGGGGAGGG + Intergenic
1100571335 12:95845754-95845776 GGCAAAAGGCAAAGAGGGAATGG + Intergenic
1110806295 13:79757880-79757902 GGCAGAGGCCAAAGCAGGGAGGG + Intergenic
1114191858 14:20445548-20445570 GACAAAAGCAAAAGAGGGGAAGG + Intergenic
1114559099 14:23578122-23578144 GGGAAAGGCCAGGGTGGGGACGG + Intronic
1115472829 14:33785909-33785931 GGCAATGTCCAAAGTGCGGAAGG + Intronic
1115486555 14:33916169-33916191 GGAAAACCACAAGGTGGGGAGGG - Intergenic
1121347291 14:93145368-93145390 GGCACACGCAGAAGTGGGGGAGG - Intergenic
1122008578 14:98727002-98727024 GGTATACTCCAAAGCGGGGATGG - Intergenic
1124353546 15:28978162-28978184 GGCAAACGCCCAAGAGGGACAGG - Intronic
1126180506 15:45780819-45780841 GGCAGAAGCCAAAGGGGGCAGGG - Intergenic
1126259817 15:46676130-46676152 GGCAATGGCTTAAGTGGGGAAGG + Intergenic
1132700818 16:1221297-1221319 GGCACCCGCCAGAGAGGGGAAGG + Exonic
1134034063 16:11016203-11016225 GGCCATCTCCAAAGTGGGTATGG - Intronic
1134452017 16:14369421-14369443 GGCACAGGCCAGAGTGAGGAAGG + Intergenic
1134662247 16:15992900-15992922 GGCAAAGGCCACAGTGGGGTGGG - Intronic
1135323342 16:21511368-21511390 GGACAACTCCAAGGTGGGGATGG - Intergenic
1136774370 16:32863820-32863842 TGCACAAGCCAAAGGGGGGAAGG - Intergenic
1136896241 16:33997694-33997716 TGCACAAGCCAAAGGGGGGAAGG + Intergenic
1140648748 16:77064301-77064323 GGCCAACGCCAGAGGTGGGAGGG - Intergenic
1142218923 16:88843440-88843462 GGCAGACGACAAAGTGCGGCCGG + Intronic
1203076797 16_KI270728v1_random:1125956-1125978 TGCACAAGCCAAAGGGGGGAAGG - Intergenic
1149253111 17:54792965-54792987 GGCAAAAACCAAAATGGTGAAGG - Intergenic
1150478531 17:65491879-65491901 GGAAAAGGCCCCAGTGGGGAGGG + Intergenic
1150601581 17:66655416-66655438 GGCACAAGCAAAAGTGAGGAGGG - Intronic
1151358145 17:73572275-73572297 GGGATAGGACAAAGTGGGGAGGG - Intronic
1151509125 17:74547519-74547541 GACAAAGGCCCGAGTGGGGAGGG - Intergenic
1152189508 17:78879896-78879918 CGCACCCGCCAGAGTGGGGACGG + Intronic
1158024347 18:52878078-52878100 AGGAAACCCCAAAGTGGGGAGGG - Intronic
1158544114 18:58381358-58381380 GGCCACAGACAAAGTGGGGAGGG - Intronic
1160969398 19:1760710-1760732 GGGAAAAGCAAAAGCGGGGATGG - Intronic
1161740421 19:6017880-6017902 GGCAAACGTGACAGTGGGGCGGG - Intronic
1161865599 19:6829971-6829993 GGCACATGCCCAAGTGGAGAGGG - Intronic
1162771760 19:12953511-12953533 GGCCAAGGCCAGACTGGGGAGGG - Exonic
1163127447 19:15251860-15251882 GGCAAAACCCAAGGTGGGGAGGG + Intronic
1166274710 19:41744961-41744983 GACAAAGGACCAAGTGGGGAGGG - Intronic
1168183371 19:54679270-54679292 GGGAAACCCAAAAGGGGGGAAGG + Intronic
927192289 2:20524935-20524957 GGCAGAGGCGGAAGTGGGGAGGG + Intergenic
927661889 2:25000506-25000528 TGCAGAGGCCACAGTGGGGAGGG + Intergenic
928240802 2:29584051-29584073 GGCAAAAGCCAAATGGGGTAGGG + Intronic
929543794 2:42842557-42842579 GACAAACGCCATAGTGGGCGAGG - Intergenic
929668743 2:43853108-43853130 TGCAAACTCCAAAGATGGGAGGG + Intronic
930180698 2:48353190-48353212 GGCAGAAGCCAAACTGGGGAGGG - Intronic
931456032 2:62410411-62410433 GGGAGACGCCAAAGTGAGGATGG - Intergenic
934100906 2:88652112-88652134 GGGAAAAGCAAAAGTGGGAAGGG + Intergenic
935417484 2:102834211-102834233 GGCCCACGGCAAAGTAGGGATGG - Intronic
937431893 2:121845792-121845814 GGCCAAATTCAAAGTGGGGATGG + Intergenic
940650496 2:156436182-156436204 GGGAAACGCGGAAGTGGGGGCGG - Intronic
944688420 2:202137918-202137940 GGCAAACGCCAAAGTGGGGATGG - Intronic
948512226 2:238476303-238476325 GGCAAGCGTCAAAGTGAGGGTGG + Intergenic
1174054871 20:47791570-47791592 GGAAGACGCTAAAATGGGGAGGG - Intergenic
1175213300 20:57375366-57375388 GGCAAAGGGCAGAGTGGGGTGGG - Intronic
1175735272 20:61381701-61381723 TGCAAAGGCCAAATTGGGGTGGG - Intronic
1178895060 21:36551074-36551096 GGCAGCCACCAGAGTGGGGAGGG + Intronic
1179957127 21:44747627-44747649 GGGACACCTCAAAGTGGGGAGGG - Intergenic
1180053292 21:45343544-45343566 CGCATAGGCCAAGGTGGGGAAGG + Intergenic
1180876516 22:19177626-19177648 GGCAACCGGCAAGCTGGGGAGGG - Intronic
1181103532 22:20557733-20557755 GGCCAAGGCCAGACTGGGGAGGG - Intronic
1182881436 22:33737252-33737274 GACAAAAGCCCATGTGGGGAAGG - Intronic
1183909210 22:41065899-41065921 GGCCAACTCCAAAGTCGGTAGGG - Intergenic
1184919165 22:47593536-47593558 GGCAAGAGCCAGAGAGGGGAGGG - Intergenic
953245093 3:41183685-41183707 GGTGAACACCAAAGTGGGGAAGG + Intergenic
956080631 3:65551992-65552014 TGCTAACTCCAAAGTGGGGGAGG + Intronic
957449542 3:80360537-80360559 GGCAAAAGGCAATGTGGTGAGGG + Intergenic
958464715 3:94443257-94443279 GGCATGCACCAAAGTGGGGGTGG - Intergenic
958954364 3:100451343-100451365 GGGAAAACCCAAAGTGGGCAGGG + Intronic
958992627 3:100864710-100864732 GGAAAAGGAGAAAGTGGGGAGGG + Intronic
959533356 3:107458453-107458475 GGCCAATGCCAAGTTGGGGATGG + Intergenic
962446500 3:135470593-135470615 AGCAAAAGCCAAAATGTGGAGGG + Intergenic
963470899 3:145740554-145740576 GGCAAAAGGCAAAGTGGAGCTGG - Intergenic
963560249 3:146855474-146855496 GGCAAATGAGAATGTGGGGAGGG - Intergenic
964553213 3:157908311-157908333 GCCATAGGCCTAAGTGGGGAGGG - Intergenic
965451122 3:168839980-168840002 GACAAAGGCAATAGTGGGGAAGG - Intergenic
969626287 4:8307359-8307381 GGCAGAGGCCAAGGTAGGGAGGG - Intergenic
975109654 4:70609219-70609241 GGCAAACACCAAGGTGGCCAGGG + Intergenic
977610591 4:99025973-99025995 GGACAACTCAAAAGTGGGGAAGG - Intronic
979810139 4:125026690-125026712 GGCAAAAGTCACAGTGGGCAGGG + Intergenic
988962502 5:36384106-36384128 GGCAAAGGCGAAACTGGGAATGG - Intergenic
991015938 5:61932527-61932549 GGCAAAAGCCAAACTGGAGCAGG - Intergenic
993905101 5:93613823-93613845 AGCAAAAGCAAAAATGGGGAGGG + Intergenic
994365499 5:98912377-98912399 GGCAAATGTCAAACTGGGCACGG + Intronic
995982209 5:118117966-118117988 TGCAAACTACTAAGTGGGGAGGG - Intergenic
1002052956 5:176581967-176581989 GGCATCCGCCAAGGTTGGGATGG + Intronic
1004193682 6:13486441-13486463 GGGAAGCGCAAAGGTGGGGAAGG + Intronic
1011961050 6:93090697-93090719 GGCATTTGCCCAAGTGGGGATGG - Intergenic
1013174029 6:107662288-107662310 AGCAAAAGCCAGAGTTGGGAGGG - Intergenic
1014260074 6:119206310-119206332 GGCAAAAAACAAAGTGGGGGTGG - Intronic
1015200491 6:130574422-130574444 GGCAAACTCCAAAGTGTTGGAGG - Intergenic
1015881599 6:137875471-137875493 GGCAAACTCAAAAGTTGGGGAGG - Intronic
1016495616 6:144658543-144658565 GGCATAGACCAAAGTGGGGGGGG - Intronic
1018446502 6:163863615-163863637 GGGAAACCCAAAATTGGGGAAGG - Intergenic
1022174530 7:27860842-27860864 GGCAAAGAGGAAAGTGGGGATGG - Intronic
1022944781 7:35271610-35271632 GGCAAAAGCCAAATAGGGAATGG + Intergenic
1023326876 7:39070373-39070395 GGCAAAAGCAGAAGTGTGGAGGG - Intronic
1025164571 7:56701528-56701550 CCTAAACTCCAAAGTGGGGAGGG - Intergenic
1025238117 7:57248569-57248591 GGAAGACGCTAAAATGGGGAGGG + Intergenic
1025705705 7:63860548-63860570 CCTAAACTCCAAAGTGGGGAGGG + Intergenic
1030286483 7:107832140-107832162 GGCAGAAGGCAAAGTGGAGAAGG + Intergenic
1032281975 7:130511145-130511167 GGCAAAGGGCAGAGTGGGAAAGG + Intronic
1033213789 7:139479865-139479887 GGCAAACCTCAAGGTGGGCAGGG + Intronic
1033605988 7:142928920-142928942 GGAAGACCCCAGAGTGGGGATGG - Intronic
1035580030 8:733831-733853 GGAAGACGTCAAAGTGGAGACGG - Intronic
1035655219 8:1300377-1300399 TGCAAACGCCAGTGTAGGGAGGG - Intergenic
1037889125 8:22613895-22613917 GGCAAAAGTCAAACTGGGAAAGG - Intronic
1039664892 8:39514572-39514594 GGCAATAGCCAAAGTGGGTAAGG - Intergenic
1040631695 8:49220891-49220913 GACAAAGGCCAAAATGGGTATGG - Intergenic
1041693826 8:60714938-60714960 CGCAGGCGCCATAGTGGGGAGGG + Intronic
1046210549 8:111068772-111068794 GTGAAATGCCAAAGTGTGGAGGG - Intergenic
1046222594 8:111235483-111235505 GGGAAAACTCAAAGTGGGGAGGG - Intergenic
1047734325 8:127752333-127752355 GACAAACTCCACAGTGGGGAAGG + Intergenic
1047844666 8:128793126-128793148 GGCAAAAGACAAAGGGGGTAGGG - Intergenic
1047979994 8:130171212-130171234 TGCAAAGGCTGAAGTGGGGAAGG - Intronic
1048049560 8:130804618-130804640 GGCATAAACCAAAGTGGGAAGGG - Intronic
1050438120 9:5630012-5630034 GACCAACTCGAAAGTGGGGAAGG - Intronic
1051679875 9:19596110-19596132 TGCAAAAGCCAGAGTGGAGAGGG + Intronic
1053566906 9:39262386-39262408 GGAAAACTCATAAGTGGGGAGGG + Intronic
1054130237 9:61356621-61356643 GGAAAACTCATAAGTGGGGAGGG - Intergenic
1054597870 9:67087181-67087203 GGAAAACTCATAAGTGGGGAGGG - Intergenic
1057354101 9:94321039-94321061 GGCAAAGGCCAAAGGGGCCAAGG - Intronic
1057653665 9:96936596-96936618 GGCAAAGGCCAAAGGGGCCAAGG + Intronic
1059283818 9:113156130-113156152 GGCAAACGTCAGTGTGGGGGTGG - Intronic
1187977748 X:24720281-24720303 GACAAACGCTACAGTGGGAAAGG - Intronic
1190937088 X:55007168-55007190 GGCAGTGGCCAAAGTGGTGAAGG + Exonic
1192148104 X:68695058-68695080 GGCAAACCCTAGAGTGGGGAGGG - Intronic
1192659505 X:73027337-73027359 TGAAAACGTCAAAGTGTGGATGG - Intergenic
1194894184 X:99418757-99418779 CGCAAAAGCGCAAGTGGGGAAGG + Intergenic
1200105584 X:153710236-153710258 TGCACAGGCCAAAGGGGGGAAGG + Intronic
1200178694 X:154136974-154136996 CACAAAGGCCAAAGTGCGGAAGG + Intergenic