ID: 944691097

View in Genome Browser
Species Human (GRCh38)
Location 2:202159191-202159213
Sequence CATCATCCAAAGATGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944691088_944691097 30 Left 944691088 2:202159138-202159160 CCCCGAAACCTGTGGATTTCACA 0: 1
1: 0
2: 1
3: 9
4: 136
Right 944691097 2:202159191-202159213 CATCATCCAAAGATGGAGCAGGG 0: 1
1: 0
2: 2
3: 16
4: 177
944691089_944691097 29 Left 944691089 2:202159139-202159161 CCCGAAACCTGTGGATTTCACAT 0: 1
1: 0
2: 4
3: 16
4: 227
Right 944691097 2:202159191-202159213 CATCATCCAAAGATGGAGCAGGG 0: 1
1: 0
2: 2
3: 16
4: 177
944691091_944691097 22 Left 944691091 2:202159146-202159168 CCTGTGGATTTCACATACAACAG 0: 1
1: 0
2: 1
3: 11
4: 155
Right 944691097 2:202159191-202159213 CATCATCCAAAGATGGAGCAGGG 0: 1
1: 0
2: 2
3: 16
4: 177
944691090_944691097 28 Left 944691090 2:202159140-202159162 CCGAAACCTGTGGATTTCACATA 0: 1
1: 0
2: 2
3: 15
4: 216
Right 944691097 2:202159191-202159213 CATCATCCAAAGATGGAGCAGGG 0: 1
1: 0
2: 2
3: 16
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944691097 Original CRISPR CATCATCCAAAGATGGAGCA GGG Intronic
905940728 1:41861171-41861193 CATGGTCCCCAGATGGAGCATGG - Intronic
906605153 1:47164132-47164154 GGCCATGCAAAGATGGAGCAGGG - Intergenic
907060657 1:51420337-51420359 CATCCTCAAAAAATGCAGCAGGG + Intronic
908709739 1:67001776-67001798 CAGCATTGCAAGATGGAGCAGGG - Exonic
910561271 1:88594464-88594486 TATCAACCAAAAAAGGAGCATGG + Intergenic
911571086 1:99517683-99517705 CATCATCCAAAGAAGGATCATGG - Intergenic
913316977 1:117561769-117561791 CAGAAGCCAAAGATGGAGGATGG + Intergenic
913344321 1:117792998-117793020 CATCTTACATGGATGGAGCAGGG + Intergenic
915923152 1:159993318-159993340 CATCCTCCAAAGATAGATCTAGG + Intergenic
916829384 1:168475364-168475386 CATCTTACTATGATGGAGCAGGG - Intergenic
919103377 1:193121235-193121257 CATCATCCAAAGAATGAAGAGGG + Intergenic
921004039 1:211075451-211075473 CACCATCCAAACGTGGATCAAGG + Intronic
922610525 1:226923781-226923803 CACAGTCCAAAGAGGGAGCAGGG + Intronic
1062858150 10:789828-789850 CAGCACCCGAAGATGGAGCCTGG + Intergenic
1066270232 10:33815337-33815359 CATCATCCAAAGTTAAAACAAGG - Intergenic
1073134113 10:101210449-101210471 TTTCTTCCAAAGATGGGGCAGGG - Intergenic
1076242776 10:128922286-128922308 CATCTTCAAAAGATGGAGAAGGG - Intergenic
1078057169 11:8018326-8018348 CATCAGCCTAAGATGGGGGATGG + Intergenic
1079850992 11:25534150-25534172 CATGATCCAATCATGGAGCAAGG + Intergenic
1079863991 11:25711982-25712004 CATCATCCAAAAAGAGAACACGG - Intergenic
1080572613 11:33569883-33569905 CATCAGCCAAAGGGGGAGAAGGG + Intronic
1080670187 11:34369276-34369298 AATCATCTCAAGATGGATCAAGG + Intergenic
1081622185 11:44625107-44625129 CAGCAGGCAAAGAGGGAGCAGGG + Intergenic
1082839029 11:57673458-57673480 GATCATCTAATGATGGAGCTGGG - Intronic
1089703943 11:120263797-120263819 CATCTTCCAAAGACGGAGCCAGG + Intronic
1091908898 12:4212829-4212851 AATCAGCCAATGATCGAGCAAGG + Intergenic
1092123146 12:6058304-6058326 GATCATCTAAGGATGGAGAAGGG + Intronic
1092219242 12:6701328-6701350 GATAATCCAAAGATGGTGCAAGG - Intergenic
1092510976 12:9156359-9156381 CAAGATCCAGAGATGGAGGAAGG - Intronic
1094158009 12:27357854-27357876 AATCATCTCAAGATGGATCAAGG + Intronic
1096358576 12:50963999-50964021 CATCATCCAAAGACGTATGAAGG - Intronic
1096754727 12:53789684-53789706 CAGCATTGAAAGATGGAGGAAGG - Intergenic
1097449387 12:59717144-59717166 CATCTTCCAAAGAGTGAGCATGG + Intronic
1099702406 12:86103699-86103721 CATCATCTCAAGATGGGGAAGGG + Intronic
1100680577 12:96915776-96915798 CATTCTATAAAGATGGAGCATGG + Intronic
1100706705 12:97208346-97208368 AATCATCTCAAGATGGATCAGGG + Intergenic
1105633757 13:22197485-22197507 CATTATGAAAAGGTGGAGCAGGG + Intergenic
1107153745 13:37142259-37142281 CATCTTCTAAAGCTGGAGAATGG + Intergenic
1108485200 13:50916850-50916872 CATCCTCCCAGGAAGGAGCAGGG + Intronic
1108529881 13:51318950-51318972 AATCATAAAAAGATGGAGGAAGG - Intergenic
1112243895 13:97710560-97710582 CAACATGCAGTGATGGAGCAGGG - Intergenic
1112677732 13:101722935-101722957 CATCATGCAAAGATGGTTCTCGG + Exonic
1115360806 14:32499472-32499494 CATCATCCAAAACTGAAGGAGGG - Intronic
1116799220 14:49425802-49425824 CATTATAGAAAGATGGAGGAAGG - Intergenic
1119783919 14:77298292-77298314 CACCCTCCAGAGATGGAGCCTGG - Intronic
1119933193 14:78567426-78567448 GAAGATCCAGAGATGGAGCAGGG - Intronic
1120644941 14:87062894-87062916 CATCTTCCCATGGTGGAGCAGGG + Intergenic
1128864731 15:71105947-71105969 CCTCATCCAGATATGGAGTATGG + Intronic
1131959023 15:97768703-97768725 CATCATAGACAGATGGAACAAGG + Intergenic
1139336244 16:66233592-66233614 CAGCATGCAAAGCTGGTGCAAGG - Intergenic
1140149670 16:72349860-72349882 CAACATACAAACATGTAGCAAGG - Intergenic
1140380643 16:74484079-74484101 CATCAAGCAAAGAGGGGGCAGGG - Intronic
1143385553 17:6527992-6528014 CAAAAGCCAAAGATGGAGCAGGG - Intronic
1145098448 17:20052703-20052725 CACTATCCAAGGAAGGAGCATGG + Intronic
1149072883 17:52563992-52564014 CATCATCAGAAGATGGTTCAAGG - Intergenic
1151190341 17:72393586-72393608 CTTCTTCCAAAGATGGTCCAGGG - Intergenic
1151646171 17:75433447-75433469 TGTCATCCAAAGATAGAACAGGG + Intergenic
1152501823 17:80716717-80716739 AATCAACCCAAGATGGATCAAGG - Intronic
1155620991 18:27779463-27779485 CATCTTCCACAGATAGAGGAAGG - Intergenic
1156366050 18:36428392-36428414 CTTCCTCCAAAGATGGAGGAAGG - Intronic
1157720161 18:49917390-49917412 AATGATCCAAAGATGCTGCATGG - Intronic
1159005437 18:63006114-63006136 CATCATGCAGAGATGGTACAAGG - Intergenic
1159403187 18:67963735-67963757 CATAAGCCAATGATGGAGCCAGG - Intergenic
1164694974 19:30236623-30236645 CATCATCTAAAAATGGATTAAGG + Intronic
1166235958 19:41456805-41456827 CAGCATCTCGAGATGGAGCAGGG + Intergenic
1166681194 19:44768177-44768199 CAGACTCCAAAGATGGAGGAAGG + Intergenic
1166760604 19:45221963-45221985 GAACCTCCAAAAATGGAGCAAGG + Intronic
925268817 2:2587499-2587521 AATGATCCAAAGATCAAGCAGGG - Intergenic
927468391 2:23353869-23353891 CAGGATCCAAGGAGGGAGCATGG + Intergenic
929547744 2:42866677-42866699 CTTCCTCCAGAGATGGGGCAGGG + Intergenic
931253689 2:60553419-60553441 AATAATACAAAGATGGCGCAGGG + Exonic
931856501 2:66307456-66307478 CTTTATCCAAAGCTGGAGAAAGG + Intergenic
932865996 2:75343813-75343835 CAGATTCAAAAGATGGAGCAAGG - Intergenic
933192184 2:79346991-79347013 CATCATCCAAACAGTGAACATGG - Intronic
933784865 2:85830514-85830536 CATCGGCAAAAGATGGAGAAGGG + Intergenic
934546918 2:95225416-95225438 CATCATCCCATGATGGAACATGG + Intronic
936869185 2:117112393-117112415 CAATATCCAAAGCAGGAGCATGG - Intergenic
937117833 2:119421441-119421463 CATCATCTTGAGATGGTGCAGGG + Intergenic
937144459 2:119630751-119630773 CTTCATCCTAACAAGGAGCAAGG - Exonic
937722636 2:125121376-125121398 AATCAACCCAAGATGGATCAAGG - Intergenic
938232359 2:129672212-129672234 CAATATCCAATGATGGAACAGGG - Intergenic
941160641 2:162030598-162030620 CCTCATGCAAAGATCCAGCAGGG - Intronic
941936698 2:170987391-170987413 CCTGATCCAAAGAATGAGCATGG - Intergenic
942123092 2:172797976-172797998 CAAGATACAAAGATGGAGAAAGG - Intronic
944691097 2:202159191-202159213 CATCATCCAAAGATGGAGCAGGG + Intronic
945215937 2:207434072-207434094 CACCCTCTAAAGATGGAGAAAGG + Intergenic
945480786 2:210343068-210343090 AATCAACCAAAGATGGATTAAGG - Intergenic
947441994 2:230131534-230131556 CACCATGCAGAGAGGGAGCAAGG - Intergenic
1169891623 20:10459509-10459531 CATCTTTAAAAGATGAAGCAAGG - Intronic
1173120242 20:40282415-40282437 TATCATCCTAATTTGGAGCAGGG - Intergenic
1173228266 20:41174695-41174717 CTTCATCCAGAGCTGGGGCATGG - Exonic
1173268297 20:41507452-41507474 GATCATCCAAATATGGAAAACGG + Intronic
1174769266 20:53283125-53283147 CATCCTCCAAAGTAGGATCATGG + Intronic
1174812800 20:53661746-53661768 CATCATCTTAGGAGGGAGCAGGG - Intergenic
1176330864 21:5547334-5547356 GGTCATCAAACGATGGAGCAGGG - Intergenic
1176396893 21:6273617-6273639 GGTCATCAAACGATGGAGCAGGG + Intergenic
1176440264 21:6715487-6715509 GGTCATCAAACGATGGAGCAGGG - Intergenic
1176464526 21:7042556-7042578 GGTCATCAAACGATGGAGCAGGG - Intergenic
1176488087 21:7424335-7424357 GGTCATCAAACGATGGAGCAGGG - Intergenic
1178160779 21:29911725-29911747 CATCTTCCTATGATGGAGGAGGG - Intronic
1178173772 21:30073676-30073698 CATCATATGAGGATGGAGCAAGG - Intergenic
1178784184 21:35637268-35637290 CAGCATCTAAAGAGGGAGAAAGG + Intronic
1183361075 22:37383871-37383893 CCTCAGCCAAAGAAGGGGCATGG + Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1183764865 22:39863623-39863645 GTTCATCCCAAGATGGAGAAAGG - Intronic
1184158928 22:42686630-42686652 CAGCATCCAAGGAGTGAGCAGGG - Intergenic
1184945189 22:47797601-47797623 AATTATTTAAAGATGGAGCAGGG + Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949917451 3:8975746-8975768 CAGCCCCCAAAGAAGGAGCAAGG - Intergenic
950024532 3:9811070-9811092 CAGCAGCCAAAGAGGGAGAAAGG - Intronic
950962467 3:17120309-17120331 CAACATGCAAAGATTGGGCATGG - Intergenic
951387713 3:22062762-22062784 CATCTTCCAGAGATACAGCAAGG - Intronic
952005206 3:28835713-28835735 CATCATGCAAGGAAGGAGCAGGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
956042683 3:65162000-65162022 CAACTTCCAGAGATGAAGCAAGG + Intergenic
956572349 3:70711446-70711468 CATCTTACAATGATGGAGCAGGG + Intergenic
957744166 3:84317241-84317263 TATCATGCAAGGCTGGAGCAAGG - Intergenic
959979695 3:112502283-112502305 TTGCATCCAATGATGGAGCAAGG + Intergenic
960047288 3:113210933-113210955 CATCATCCCAGGATGGAGCCAGG - Intergenic
960070647 3:113426242-113426264 CTTCTTCCACAGCTGGAGCAGGG + Exonic
960303078 3:116027933-116027955 GTTCATTCAAAGATGGGGCAAGG + Intronic
966578246 3:181528194-181528216 ACTCAACCCAAGATGGAGCAAGG - Intergenic
968721165 4:2206240-2206262 CATCAGCTCAAGATGGATCAAGG + Intronic
972220991 4:36954083-36954105 CATCCTCCTAAGATGGAACAAGG - Intergenic
972465162 4:39348716-39348738 CCTCTTCAAAAGATGGAGCTTGG + Intronic
973665020 4:53150362-53150384 CATCTGCCCAAGATGAAGCAAGG + Intronic
973961991 4:56119865-56119887 CATCAACAAAGTATGGAGCAGGG - Intergenic
975896798 4:79102588-79102610 CAACCTCCCAAGATTGAGCAAGG - Intergenic
976070494 4:81234679-81234701 CACCATGCAAAGAAGAAGCAAGG - Intergenic
978561661 4:110040641-110040663 CAGCATCGAAAGATGGAACCTGG + Intergenic
981269979 4:142834503-142834525 GGTCATCCTAAAATGGAGCATGG + Intronic
985282005 4:188296754-188296776 AATCATACAAAGTAGGAGCATGG + Intergenic
986383631 5:7209763-7209785 CATTATCCAAAGCTGGATAATGG - Intergenic
987374148 5:17218256-17218278 CAGCAGCCAAAGATGGAGGGTGG + Intronic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
990032731 5:51281721-51281743 AATGATCAAAATATGGAGCAAGG + Intergenic
990087469 5:51996338-51996360 CTGCATCCAAAGATGCAGTATGG + Intergenic
991266376 5:64723981-64724003 CACCTTCCAATGATGAAGCAAGG - Exonic
991985608 5:72283454-72283476 CCTCATCCACAGCTGGAGCTTGG + Intronic
992523733 5:77584815-77584837 AATCAACCCAAGATGGATCAAGG + Intronic
994508936 5:100678695-100678717 TCTCATCTAAAGATGGAGCTTGG + Intergenic
997528628 5:134568953-134568975 AATCATCGGAAGATGGGGCAGGG + Intronic
998619062 5:143774453-143774475 CATCATCCAAAGGGGCAGCCAGG - Intergenic
998720260 5:144938096-144938118 CAACTTCCAAAGATTGAGCCAGG + Intergenic
998933577 5:147208965-147208987 TATCAAACAAAGATGGAACATGG - Intergenic
999599479 5:153245747-153245769 AATCAACCCAAGATGGATCAAGG - Intergenic
1002803431 6:549013-549035 AATCATCCAAAGCTTTAGCAGGG + Intronic
1002810431 6:623021-623043 CCTCATCCTCAGAAGGAGCAGGG + Intronic
1003385356 6:5662495-5662517 CTTCATCCAGAGAAGGATCAGGG - Intronic
1006449438 6:34097675-34097697 CACCATCCAAAGGTGGAACGGGG + Intronic
1006524329 6:34590812-34590834 CATCATCCAAAGAGAGGGGAGGG + Intronic
1006681277 6:35798314-35798336 CATGAGCCTCAGATGGAGCAGGG + Intergenic
1009522026 6:64695004-64695026 GATGAACCAAAGATGCAGCATGG - Intronic
1009938792 6:70265305-70265327 CATCATCAAAAGAAGGAGAAAGG + Intronic
1012137362 6:95575510-95575532 GGTCATCCAAAGATGTAACAGGG + Intergenic
1012168362 6:95987896-95987918 CATCAGCCAGAAATGGAGAATGG - Intergenic
1016558276 6:145365409-145365431 CATCATCCAAATATTGAACATGG + Intergenic
1019267665 7:127458-127480 CAACATCCACAGATTCAGCAGGG - Intergenic
1019952931 7:4388369-4388391 TGACATCCAAAGATGAAGCAGGG - Intergenic
1026489776 7:70852698-70852720 CTTCTTCCAAAGTTGGAGCCAGG + Intergenic
1026918556 7:74138448-74138470 CATCATTCAAAGAGGCAGGAAGG - Intergenic
1027572869 7:79892819-79892841 CATCTTCCAAAGAGTGAACATGG + Intergenic
1027627168 7:80560640-80560662 CATCCTCCTAAGATGGAACCAGG - Intronic
1039045669 8:33447055-33447077 CGTCATCCATAGATGGTGTATGG + Intronic
1039111605 8:34046610-34046632 CATCACCCAAATACTGAGCATGG + Intergenic
1039318868 8:36405782-36405804 TAGCATCCAAAGATGGTGGAGGG - Intergenic
1039427160 8:37495428-37495450 CATCAGCCAAAGAGAGTGCAAGG + Intergenic
1039797778 8:40929952-40929974 CATCATCCAAACAGTGAACATGG + Intergenic
1042970787 8:74406850-74406872 CATCTTCCAAAGCTAGAGGAGGG + Intronic
1044770570 8:95626782-95626804 CATCACACAAAGATGGAGAAAGG + Intergenic
1045720430 8:105103400-105103422 CATCTTCCAAAGATGGAGAATGG - Intronic
1047414184 8:124650444-124650466 GATCATCCATATATGGCGCAGGG + Intronic
1049542681 8:143215595-143215617 CATTCTCCAAAGCTGGTGCAGGG - Intergenic
1051541861 9:18229026-18229048 CATCATCCAAAAATTTAACATGG + Intergenic
1052104217 9:24492409-24492431 CAAAATCCAAAGATGGAGCGAGG + Intergenic
1052697119 9:31891920-31891942 CTGCATCCAAAAATGAAGCATGG + Intergenic
1053523470 9:38805479-38805501 CATCTTCCAAGCATGAAGCAAGG - Intergenic
1054195699 9:62029898-62029920 CATCTTCCAAGCATGAAGCAAGG - Intergenic
1054642709 9:67558791-67558813 CATCTTCCAAGCATGAAGCAAGG + Intergenic
1054874150 9:70077718-70077740 GAACATCCAAAGAGGAAGCAAGG - Intronic
1057865072 9:98674088-98674110 CATCATCTAGAGAGGGAACAGGG + Intronic
1061373910 9:130213016-130213038 CATCATCAGAAGGTGGAGGAGGG - Intronic
1061795575 9:133084004-133084026 CATCAGCCAAAAATGGTGCGAGG - Intronic
1203431231 Un_GL000195v1:92992-93014 GGTCATCAAACGATGGAGCAGGG + Intergenic
1190599434 X:52074597-52074619 CACCCTCCCAAGATGGAGCCAGG - Intergenic
1190609390 X:52179476-52179498 CACCCTCCCAAGATGGAGCCAGG + Intergenic
1191140425 X:57110674-57110696 AATCATCTCAAGATGGATCAAGG + Intergenic
1193299372 X:79871140-79871162 CATCCTCCCAAGACTGAGCAAGG + Intergenic
1194252156 X:91589230-91589252 CACCCTCCAAAGATGGAACCAGG + Intergenic
1194685297 X:96906715-96906737 CATAATCCAATGATGGATGATGG + Intronic
1195544994 X:106104271-106104293 CGTCAGCCAAAGATGGATGAAGG + Intergenic
1195681050 X:107546974-107546996 CCTCATGCAGAGATGGAGGAGGG - Intronic
1195838649 X:109148266-109148288 AATCAACCCAAGATGGATCAAGG + Intergenic
1199360232 X:146908533-146908555 CATCATTAAAAAATGTAGCAAGG + Intergenic
1200571087 Y:4830469-4830491 CACCCTCCAAAGATGGAACCAGG + Intergenic
1200585844 Y:5003650-5003672 CATCATCCCAATTTGGAGCGCGG - Intronic