ID: 944691897

View in Genome Browser
Species Human (GRCh38)
Location 2:202166069-202166091
Sequence AAGGGCTTGGCCAAGTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 404}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944691890_944691897 24 Left 944691890 2:202166022-202166044 CCATATCATAAATCACACATGCA 0: 1
1: 0
2: 1
3: 20
4: 277
Right 944691897 2:202166069-202166091 AAGGGCTTGGCCAAGTGTGATGG 0: 1
1: 0
2: 2
3: 36
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944691897 Original CRISPR AAGGGCTTGGCCAAGTGTGA TGG Intronic
900522933 1:3114930-3114952 GAGGCCTTGGCCAAGTGTGCAGG - Intronic
900805947 1:4768592-4768614 AAGAGGTTGGTCAGGTGTGAGGG + Intronic
901203657 1:7481524-7481546 AAGGGCTTGCCAGAGAGTGAGGG - Intronic
901386166 1:8910752-8910774 ATGAGGTTGGCCAAGTGTGGTGG + Intergenic
902500282 1:16906502-16906524 CAGGGGCTGGCCAGGTGTGATGG - Intronic
902957137 1:19933459-19933481 ATGGGGTTGGCCAGGTGTGGTGG + Intergenic
903907807 1:26697834-26697856 AAGGGCCTGGCCGGGGGTGAGGG + Intronic
903943357 1:26946562-26946584 CAAGGCTTGGCCGGGTGTGATGG + Exonic
903955596 1:27023157-27023179 AAGGCCTTGGGCAGGTGAGAAGG - Intergenic
904662664 1:32096746-32096768 AAGGCCTAGGCCAAGTGTAGTGG - Intronic
904699584 1:32350586-32350608 AAGGGCTTGGCCAGGTGTGGTGG - Intergenic
904760296 1:32798667-32798689 AAGAAATTAGCCAAGTGTGATGG + Intronic
904766960 1:32857140-32857162 AGGGGCTTGACCAAATGAGATGG - Exonic
904840963 1:33371510-33371532 ATGGCAGTGGCCAAGTGTGATGG - Intronic
906112545 1:43333833-43333855 AAGGCCTGGGCCAAGTGTGGTGG + Intergenic
906265374 1:44424825-44424847 AGGTGCTTGGCCAGATGTGAGGG + Intronic
906617660 1:47245304-47245326 AAGCACTTTGCAAAGTGTGAAGG + Intergenic
906782296 1:48583570-48583592 CAGGGGTTAGACAAGTGTGAAGG + Intronic
906957547 1:50387835-50387857 AAGAGCATGGCCAAGTGCGGTGG + Intergenic
907423339 1:54362402-54362424 AAGGGCCTGGCAAAGAGTGAAGG + Intronic
907554577 1:55333443-55333465 AGGGGCTTGGCCCAGTGAAAAGG + Intergenic
907689602 1:56649392-56649414 AAAAGCTTGGCCAGGTGTGGTGG + Intronic
908187616 1:61667795-61667817 CAGGTATTGGCCAGGTGTGATGG + Intergenic
911012865 1:93299966-93299988 AAGGGCCCGGCCAGGTGTGGTGG - Intergenic
911230590 1:95357210-95357232 AATGACTTGGTCAAGTGTCAGGG + Intergenic
911885881 1:103299015-103299037 AATGACTGGGCCAAGTGAGAGGG + Intergenic
913157770 1:116116586-116116608 AAGGGTGTGGCAAAGTGTGATGG + Intronic
914778448 1:150760598-150760620 AAAGTCTTGGCCAGGTGTGGTGG + Intronic
914871385 1:151477787-151477809 AAGAGCTTGGCCAGGTGTGGTGG + Intergenic
914871553 1:151479293-151479315 AATGGCTTGCCCAGGTGTGGTGG + Intergenic
915284074 1:154841929-154841951 AAGAGGATGGCCAGGTGTGAAGG + Intronic
916180572 1:162079975-162079997 AAGGGCTGGAACAAATGTGATGG - Intronic
917692949 1:177487706-177487728 AGTGGCTTGACCAAGTGGGAGGG - Intergenic
917759153 1:178136466-178136488 AAGGACTTGGCCAGGTGTGGTGG + Intronic
917900011 1:179532594-179532616 AAGAAGTTGGCCAAGTGTGGTGG + Intronic
917994623 1:180422493-180422515 AAGGGATGGGCCAGGTGTGGTGG - Intronic
918111037 1:181455804-181455826 AAGGGCATGGCCTAGGGTGTAGG - Intronic
919574042 1:199284484-199284506 AAGGGTTAGGCCAAATTTGAAGG + Intergenic
919643628 1:200069539-200069561 AATTGTTTGGCCAAGTGTGGTGG - Intronic
919661158 1:200249040-200249062 AGGGGCTTGGACATTTGTGATGG - Intergenic
919878086 1:201885229-201885251 CAGGACTTGGCCAAGTCTCATGG - Intergenic
919904376 1:202067963-202067985 AAGGTCTTGGCCCAGTGCGGCGG + Intergenic
920790250 1:209083235-209083257 AAGGCATTGGCCTAGAGTGAAGG - Intergenic
921016253 1:211194243-211194265 AAGGGATTGGCCGAGTGCGGTGG - Intergenic
921727121 1:218535848-218535870 AAGAGCAAGGCCAGGTGTGATGG - Intergenic
923552801 1:234977652-234977674 CTGTGCCTGGCCAAGTGTGAGGG - Intergenic
924343058 1:243053030-243053052 CAGGCCTTGGCCAGGTGTGGTGG - Intergenic
1063503257 10:6573827-6573849 AAGAGCTAGGCCAGGTGTGGTGG + Intronic
1064107820 10:12515147-12515169 AAAGGCTAGGCCAGGTGTGGTGG - Intronic
1064248275 10:13687001-13687023 GATGGCTTGGCCAGGTGTGGTGG + Intronic
1064406780 10:15071068-15071090 AATGGCTAGGTCAGGTGTGATGG - Intronic
1065666531 10:28069315-28069337 AACACCTTGGCCAGGTGTGATGG + Intronic
1065804824 10:29384611-29384633 AATCACTGGGCCAAGTGTGATGG + Intergenic
1065935036 10:30513654-30513676 AAGGGTTTGGCCAGGTGTGGTGG - Intergenic
1065944317 10:30593172-30593194 AATCACTGGGCCAAGTGTGATGG - Intergenic
1066236586 10:33490833-33490855 AAAGGCTCGGCCAGGTGTGGTGG + Intergenic
1067025848 10:42843536-42843558 ACGGGGTTGGCCAGGTGTGATGG - Intergenic
1067305093 10:45056386-45056408 AAGGACTTGGCCGGGTGTGGTGG + Intergenic
1067959199 10:50828833-50828855 TAAGCCTTGACCAAGTGTGAGGG - Intronic
1068370601 10:56109306-56109328 TAGGGAGTGGCCAAGTGTGGTGG - Intergenic
1070147841 10:73787562-73787584 AAGGGGTTGGCCAGGTGCGGTGG + Intronic
1070760478 10:79021322-79021344 ATGGGCTTGGTCAAGAGTGGAGG - Intergenic
1071077728 10:81774492-81774514 ATGGGCTGGGCCAGGTGTGGTGG - Intergenic
1071888867 10:89980821-89980843 ATGGTCTTGGCCAGGTGTGGTGG + Intergenic
1072483158 10:95828996-95829018 ATGGGCATGGCCAGGTGCGATGG - Intronic
1073039420 10:100592042-100592064 GAGGACTTAGCCAAGTGTGGTGG + Intergenic
1073318319 10:102598441-102598463 AAGGGCTTGGCCGGGTGCGGTGG - Intronic
1073753686 10:106558430-106558452 AATGGCTTGGCCAAAGGGGAAGG - Intergenic
1074510128 10:114104124-114104146 AAGAGTTTGGCCAGGTGTGGTGG + Intergenic
1074582546 10:114734145-114734167 AAGGTCATGGCCAAGCGTGATGG - Intergenic
1075039887 10:119099692-119099714 AAGAGCTTGGCCAGGCGTGGTGG + Intergenic
1075795244 10:125115521-125115543 AAGGGCCTGACCACCTGTGAAGG - Intronic
1076056907 10:127383458-127383480 AAGAGTTTGTCCAATTGTGATGG + Intronic
1076811659 10:132889413-132889435 GAGGGCCTGGCAGAGTGTGAAGG - Intronic
1076879438 10:133232570-133232592 AACGGCTTGCCCAGGTCTGAGGG + Intergenic
1077245368 11:1534440-1534462 AAGGGCTTTTCCAAGAGGGAAGG - Intergenic
1078973013 11:16436967-16436989 AAGGGCCTGGCCAACTGTGGTGG + Intronic
1078981958 11:16545797-16545819 AAAAGATTAGCCAAGTGTGATGG + Intronic
1079341778 11:19617621-19617643 AAGTGCATGGTAAAGTGTGAGGG + Intronic
1079599571 11:22294445-22294467 GAGGGTTTGGCCAGGCGTGATGG - Intergenic
1080045249 11:27801191-27801213 AAGGGCGAGACAAAGTGTGAGGG + Intergenic
1081557506 11:44179094-44179116 AAGAACTTGGCCAATTCTGATGG + Intronic
1081569818 11:44282846-44282868 AAGGGCTTGCACTGGTGTGATGG + Intronic
1081687527 11:45053342-45053364 GAGGGCTATGCCAGGTGTGAGGG + Intergenic
1082049910 11:47762623-47762645 GGGGTCTCGGCCAAGTGTGATGG + Intronic
1082816331 11:57512302-57512324 AAGGGGTAGGCCAAGAGTGGTGG + Intronic
1083360309 11:62102630-62102652 AAATGCTGGGCCAGGTGTGATGG - Intergenic
1083955731 11:65981973-65981995 AAGGGCACAGCCAGGTGTGAAGG + Intergenic
1085169466 11:74436552-74436574 AAGCTTTTAGCCAAGTGTGATGG + Intergenic
1085481173 11:76824126-76824148 CAGGGCTTGGCCAAGAGAGAAGG - Intergenic
1085655130 11:78307468-78307490 AAGGACTTGGCCAGGCATGATGG + Intronic
1085823542 11:79818675-79818697 TAGGCCTTGGCCAAGGTTGAGGG - Intergenic
1086787100 11:90982625-90982647 AAGATCTGGGCCAAGTGCGATGG - Intergenic
1088470121 11:110181592-110181614 CAGGGCTTGGCCAAGAATGGGGG + Intronic
1088798778 11:113286856-113286878 AGGAGCTTGGCCAAGTGTGGTGG - Intergenic
1090409261 11:126496527-126496549 AAGGTGTTGGCCAAGTTTGGAGG + Intronic
1091546163 12:1502693-1502715 CGGGCCCTGGCCAAGTGTGAGGG + Intergenic
1092824503 12:12385793-12385815 ATGAACTTGGCCAAGTGTGGCGG - Intronic
1093315769 12:17647819-17647841 AAGGGCTTGGGCAATTATAAAGG - Intergenic
1094188519 12:27671782-27671804 AGGAACTTGGCCAAGTGTGGTGG + Intronic
1094566540 12:31603549-31603571 AAAGGATTAGCCAGGTGTGATGG + Intergenic
1096355854 12:50940428-50940450 AAAGGCTTGGCCAGGTTTAATGG + Intergenic
1096498228 12:52050907-52050929 AAGGGCTTGGGAAGGTGTAAAGG + Intronic
1097263190 12:57731097-57731119 AATTGCTGGGCCAAGTCTGATGG - Intronic
1097590081 12:61563665-61563687 CAGGGCTTTGTCAAGGGTGATGG + Intergenic
1097837383 12:64286947-64286969 AAGGACTTGGCCAGATGTGGTGG + Intronic
1098636151 12:72786079-72786101 AAGGACTTGAACCAGTGTGATGG + Intergenic
1099992408 12:89738148-89738170 AAGGGATAGGCCAGGTGTGGTGG + Intergenic
1100262915 12:92949615-92949637 AAGGGATTAGCCAGGTGTGGTGG + Intergenic
1103522017 12:121542430-121542452 TAGGCCTTGGCCATGTGTGGTGG - Intronic
1103700672 12:122847356-122847378 CTGGCCTTGGTCAAGTGTGAAGG + Intronic
1104457804 12:128929672-128929694 AAGGGCTAGGCCAGGTGTGGTGG + Intronic
1104653609 12:130556723-130556745 TTGGGCTTGGCCAATGGTGATGG - Intronic
1105896516 13:24721106-24721128 AATGGCTTGGCCAAGCGCGGTGG + Intergenic
1105905328 13:24803982-24804004 AATGGCTTGGCCAGGTATGGTGG + Intronic
1106708104 13:32302890-32302912 GATGGCTTGGACAAGGGTGATGG - Intergenic
1108421098 13:50250558-50250580 TAGAGATTGGCCAAGCGTGAAGG + Intronic
1109281306 13:60358950-60358972 TAGATCTTGGCCAGGTGTGATGG + Intergenic
1114069249 14:19094971-19094993 AAGATCTTGGCCCAGTGTCAGGG + Intergenic
1114080811 14:19200423-19200445 GAGGGCCTGGCCATGGGTGAGGG + Intergenic
1115493684 14:33982600-33982622 AAGTGCTTGGCCAGGCGTGGTGG - Intronic
1115813374 14:37134803-37134825 TATGTCTTGGCCAAGTGTGGTGG + Intronic
1115821376 14:37215778-37215800 AAGGGATCGGCCAGATGTGATGG + Intronic
1116459488 14:45155931-45155953 AAGGGCTAGGGCAAGGGTGGTGG + Intronic
1117134231 14:52717607-52717629 AAGTACTTGGCCAGGTGTGGTGG - Intronic
1117995703 14:61476255-61476277 CAGTGCCTGGCCAATTGTGAGGG - Intronic
1118012149 14:61620807-61620829 AGGGGCTTGGCTAAGTGGGAGGG - Intronic
1119763854 14:77175602-77175624 AATGGGTTGGCCAGGTGTGGTGG - Intronic
1120911897 14:89674528-89674550 AAAGACTTGGTCAAGTGTGGTGG + Intergenic
1121216819 14:92254900-92254922 CTGGGCGTGGCCAAGTGGGAGGG + Intergenic
1122027530 14:98888459-98888481 CAGGGCTGGGCCAAGTCTGTGGG - Intergenic
1122095170 14:99365246-99365268 AAAGGATTGGCAAAGTGTGGCGG - Intergenic
1122732475 14:103811373-103811395 AAGGACTTGGCCAGGTGTGGTGG + Intronic
1123668227 15:22627283-22627305 AAGGCCTTGGCCGGGCGTGATGG + Intergenic
1125458783 15:39888436-39888458 AGAGTCTTAGCCAAGTGTGATGG - Intronic
1125618206 15:41035287-41035309 AATTCCTTGGCCAGGTGTGATGG + Intronic
1127084853 15:55415178-55415200 AAGGGCTTGGCCGGGCGTGGTGG + Intronic
1127121708 15:55777541-55777563 CAGGGCTGGGCAGAGTGTGAGGG + Intergenic
1127360448 15:58240582-58240604 AAGGGCTTGCCCAGGAGTGTTGG + Intronic
1127429107 15:58884602-58884624 AAGGAATTGGCCAGGTGTGGTGG - Intronic
1127466117 15:59246476-59246498 AAAGGAATGGGCAAGTGTGAAGG - Intronic
1127823153 15:62678080-62678102 AAGTGCTTGGCCAGGGGTGGTGG - Intronic
1128107759 15:65057105-65057127 GAGGGCTTGGCCACCTTTGAAGG + Intronic
1128157637 15:65401853-65401875 AAGCTCTTGCCCCAGTGTGATGG - Intronic
1128283910 15:66419955-66419977 AATGCCTTGGCCAGGTGTGGTGG + Intronic
1129309924 15:74700023-74700045 AAAAGCTTAGCCAGGTGTGATGG - Intergenic
1129451304 15:75652706-75652728 GAGGGCTTGGCCCATTGGGAGGG - Intronic
1131194106 15:90341369-90341391 AAAAACTTAGCCAAGTGTGATGG - Intergenic
1131273856 15:90964024-90964046 AATGGCTTGGCCAGGCATGATGG - Intergenic
1131634272 15:94213484-94213506 AAGGGCTTCCCAAAGTGTAATGG + Intergenic
1131689100 15:94807198-94807220 AAAGAATTGGCCAAGTGTGGTGG + Intergenic
1134625875 16:15722144-15722166 AAGGATTTGGCCAGGTGTGGTGG - Intronic
1135103877 16:19630619-19630641 TAGGGCTTGGCCAGGTGCGGTGG - Intronic
1135200851 16:20436655-20436677 AAGGGCTAGGCCGGGTGTGGTGG - Intronic
1135218264 16:20591212-20591234 AAGGGCTAGGCCGGGTGTGGTGG + Intergenic
1135394370 16:22119728-22119750 TAGTTCTTGGCCAGGTGTGATGG + Intronic
1135410718 16:22232377-22232399 AAGAAGTTGGCCAAGTGTGGTGG - Intronic
1136415927 16:30103726-30103748 AAGAGCTTGTCCAAGTATGGAGG - Intergenic
1136476544 16:30517161-30517183 CAGGGCTTGGCCAGGTGCGGTGG + Intronic
1136565357 16:31066402-31066424 TAGGGCTTAGCCAGGTGTGGTGG + Intronic
1138394913 16:56696375-56696397 AAGACCTTGGCCAGGTGTGGTGG - Intronic
1138682215 16:58693340-58693362 GAGAGCATGGCCAGGTGTGATGG + Intergenic
1139493392 16:67299311-67299333 AAGGGCAGAGCCAAGGGTGATGG + Intronic
1139587486 16:67913433-67913455 AGGGTCTTGGCCAGGTGTGGTGG - Intronic
1140212708 16:72983417-72983439 AAGGCCTAGGCCAGGTGCGATGG + Intronic
1140407603 16:74721453-74721475 AACGGCTAGGCCAAGCATGATGG - Intronic
1140538061 16:75729297-75729319 AAAGGCATGGCCAGGCGTGATGG - Intronic
1141946414 16:87313441-87313463 AGAGGCTTGGCCAGGTGTGGTGG + Intronic
1142293855 16:89206656-89206678 AGCATCTTGGCCAAGTGTGATGG - Intergenic
1142524275 17:527897-527919 AAGACTTTGGCCAAGTGCGATGG - Intronic
1142663770 17:1449748-1449770 AAGGGCTTGGCCAAGTCTACTGG - Intronic
1143055544 17:4159289-4159311 AAGAGCTTGGCCAGGTGCGGTGG - Intronic
1143067592 17:4262547-4262569 AAGGTCTTGGCCCCGTGTGGTGG - Intronic
1143723684 17:8831175-8831197 CAGGGCTTAGCCAGGTGTGGTGG + Intronic
1144483961 17:15649778-15649800 ATGAGCTTGGACAAGTGTGGTGG + Intronic
1144774317 17:17777358-17777380 AAGGGCCTGGGCATGTGTGGGGG + Intronic
1145145339 17:20475154-20475176 AAAGGCTAGGCCAGGTGTGGTGG - Intergenic
1145937961 17:28726208-28726230 GAGGGCTTCGCCAACTGTGTGGG - Exonic
1147675639 17:42203226-42203248 AAATGCTTGGCCAAGTGCGGTGG - Intronic
1149613574 17:57977412-57977434 AATGTTTTGGCCAGGTGTGATGG - Intronic
1150622315 17:66817167-66817189 AAGGCTTTGGCCAGGTGTGGTGG - Intergenic
1151297188 17:73193960-73193982 AAGGGCTTGGCCGGCTGTGGTGG - Intronic
1151679098 17:75614538-75614560 AAGGGGGTGGCCAAGGCTGAGGG - Intergenic
1152376125 17:79919876-79919898 AGGGGCATGGACAGGTGTGAGGG + Intergenic
1154135347 18:11772974-11772996 CAGGGCTGGGCCCACTGTGACGG - Intronic
1154244996 18:12688825-12688847 AAGTTCTTGGCCAGGTGTGGTGG + Intronic
1156439862 18:37174084-37174106 AAGGGCTTGGCAAGGTGCTAGGG - Intronic
1156719072 18:40047599-40047621 GAGTTCTCGGCCAAGTGTGATGG - Intergenic
1157745012 18:50127726-50127748 TAGTGCTTGGCCAAATGTGTGGG - Intronic
1158134353 18:54189934-54189956 AAGTTCTTGGCCAGGTGTGGAGG - Intronic
1158615503 18:58983144-58983166 CAGGTCATGGCCACGTGTGAAGG + Intronic
1158965555 18:62619328-62619350 AAGGAATAGGCCAAGTGTGGCGG - Intergenic
1160975728 19:1791538-1791560 ATGGGCCTGGCCAGGTGTGGTGG - Intronic
1161382417 19:3972640-3972662 AATGGGTTGGCCAGGTGTGGTGG + Intergenic
1161719000 19:5892962-5892984 TAGGGCTTGGACAGGTGTCAGGG + Exonic
1162141171 19:8586346-8586368 AAGTGCTCGGCCCAGTGTGCAGG - Exonic
1162562489 19:11425780-11425802 AGGGGCGGGGCCAAGAGTGAGGG + Intronic
1162895656 19:13763491-13763513 GAGGCATGGGCCAAGTGTGAAGG + Intergenic
1163088176 19:14998251-14998273 GAGATCTTGGCCAGGTGTGATGG + Intronic
1164074090 19:21797764-21797786 AAGGCCTTTGCCAGGTGTGGTGG + Intergenic
1164601520 19:29566473-29566495 AGGGGAGTGGGCAAGTGTGATGG + Intergenic
1164601850 19:29567707-29567729 AGGGGCGTGGCCTTGTGTGATGG + Intergenic
1164742570 19:30587453-30587475 AAGGGCTTCACCATGGGTGATGG - Intronic
1166100123 19:40566675-40566697 AAGGATTAGGCCAGGTGTGACGG + Intronic
1167043136 19:47034587-47034609 AAAAGCTTGGCCAGGTGTGGTGG + Intronic
1167257510 19:48439922-48439944 AGGGCCTAGGCCAAGTGTGGTGG + Intronic
1167897134 19:52591123-52591145 ATGGGCTTGGCCAGGCGTGGTGG - Intergenic
1168534029 19:57154273-57154295 AAGGACTTGGCCAGATGTGGTGG - Exonic
1168645553 19:58056839-58056861 AAGGACTTGGCCCAGGGTGCTGG + Intergenic
925062223 2:901774-901796 AAGGGCCTGGCCAGGTGCGGTGG + Intergenic
926888671 2:17620365-17620387 AAGGGATTGGCAAAGCGAGAAGG + Intronic
927515443 2:23669293-23669315 GAGTGCTGAGCCAAGTGTGATGG + Intronic
928069147 2:28197138-28197160 AGGGTCTTGGCCAGGTGTGGTGG - Intronic
928545514 2:32325938-32325960 AAGCTCTTGGCCAGGTGTGGTGG - Intergenic
929122314 2:38493814-38493836 AAGGTATTGGCCAGGTGTGGTGG - Intergenic
930162839 2:48175929-48175951 AAGAGCTTGGCCAGGAGTGGTGG - Intergenic
930639972 2:53844353-53844375 AATGAATAGGCCAAGTGTGATGG + Intergenic
931105523 2:59051143-59051165 GAGGGCTAGGCCAGGAGTGATGG - Intergenic
932506815 2:72241917-72241939 AAGAGCCTGGCCAGGTGTGGTGG + Intronic
933150281 2:78906303-78906325 AAGGGTTTGCCCTAGTCTGAAGG - Intergenic
933696464 2:85222380-85222402 AAAGGCTTGGCCAGGCGTGGTGG + Intronic
933698398 2:85237255-85237277 CAAAGCTTGGCCAAGTGTGTGGG - Intronic
934526066 2:95052475-95052497 AAGGGCTTGGCCAGGTGTAGGGG + Intronic
935275370 2:101471741-101471763 GAGAGCTTGGCCAAGTCTCAGGG - Intronic
937512059 2:122606981-122607003 AAAAAATTGGCCAAGTGTGATGG + Intergenic
938837270 2:135118924-135118946 AAGGGCTCAGTCCAGTGTGAGGG - Intronic
939484914 2:142798887-142798909 ATTGTCTTGGCCAGGTGTGATGG - Intergenic
940365161 2:152840105-152840127 AAGGGCTTTACAAAGTGTAATGG + Intergenic
942350331 2:175046012-175046034 AAGGGACAGGCCAAGTGTGGTGG - Intergenic
943761847 2:191618601-191618623 TTAGGCTTGGCCAAGTCTGAAGG - Intergenic
944216165 2:197258251-197258273 AAAGGATTAGCCAAGTGTGGCGG - Intronic
944492570 2:200272843-200272865 ACGAGATTGGCAAAGTGTGATGG - Intergenic
944691897 2:202166069-202166091 AAGGGCTTGGCCAAGTGTGATGG + Intronic
945711315 2:213299563-213299585 AAGAACTTGGCCCAGTGTGGTGG - Intronic
946729642 2:222696750-222696772 GAGGAGTTGGCCAAGTGTGGTGG + Intronic
946823576 2:223654466-223654488 TATGGTTTGGCCAAGTGTGGTGG - Intergenic
947056927 2:226114692-226114714 AAAGCCTTGGCCGAGTGTGCAGG - Intergenic
947231044 2:227886657-227886679 AAGGCCAAGGCCAAGTGTGGTGG + Intronic
947590902 2:231384711-231384733 AAGGTCTAGGCCAGGTGCGATGG - Intergenic
947726006 2:232401176-232401198 ATGGCCTTGGCCAAGCGTGGTGG - Intergenic
948271923 2:236680955-236680977 AAGGGCTGAGCCAGGAGTGATGG + Intergenic
948638190 2:239354068-239354090 AAGGGCTTGTCTGTGTGTGATGG - Intronic
948731796 2:239968905-239968927 AAGGGCTTAGCCCAGTATCAAGG - Intronic
949030410 2:241794233-241794255 AAAGTCTTGGCCAGGTGTGGTGG - Intronic
1169028818 20:2392372-2392394 GAGGGCTTGGCCTAGTCTGAAGG - Intronic
1169353500 20:4889217-4889239 AAGTGCTTCGCCACGTGTGTGGG + Intronic
1169883171 20:10369360-10369382 AATGTCTTGGCCAGGTGTGGTGG + Intergenic
1170594036 20:17792252-17792274 AAGGGCATGGGCAAGGGGGAAGG + Intergenic
1170684562 20:18557425-18557447 TAGGGCCTGGCCAGGTGTGGTGG - Intronic
1170778789 20:19404766-19404788 AAGAGCTTGGCCATGGCTGAAGG + Intronic
1172180136 20:32998049-32998071 AAAGTCTTGGCCAGGTGTGGTGG + Intronic
1172410285 20:34716461-34716483 AACGTTTTGGCCAGGTGTGATGG + Intronic
1172557600 20:35855964-35855986 AATAACTTGGCCAGGTGTGATGG - Intronic
1173200257 20:40949496-40949518 AGGGGATTGGCCAAGGCTGAGGG + Intergenic
1173449663 20:43151572-43151594 AAGAACTTGGCCAGGTGTGGTGG + Intronic
1174147973 20:48465432-48465454 AAGGTGTTGGCCAAGGGTGGAGG + Intergenic
1175088641 20:56483473-56483495 AAAAACTTAGCCAAGTGTGATGG - Intronic
1175707143 20:61188159-61188181 AAGGGCGTGGCCAGATGTGCTGG - Intergenic
1180148458 21:45935129-45935151 TAGAGCTGGCCCAAGTGTGAGGG - Intronic
1180159085 21:45991074-45991096 CAGCGCTTGGCCAACCGTGAAGG - Intronic
1180499962 22:15922262-15922284 GAGGGCCTGGCCATGGGTGAGGG - Intergenic
1182144256 22:27987442-27987464 AAGGTCTTGGCCAGGTGCGGTGG + Intronic
1182752242 22:32651061-32651083 GAGATCTTGGCCAACTGTGAGGG + Intronic
1183621047 22:38972935-38972957 AAGGGCTTGGGCTGGTGTGGTGG - Intronic
1184046131 22:41973232-41973254 AAGGTTTTGGCCAGGTGTGGTGG + Intergenic
1184377270 22:44122202-44122224 AAGGTCTTAGCCAGGTGTGGTGG + Intronic
1184387877 22:44186573-44186595 CAGGGCTGGGCCAGGTGTGCTGG - Intronic
950518592 3:13483036-13483058 AGGGTCTTGGCCAGGTGTGGTGG - Intronic
950862914 3:16166043-16166065 AAGAGCTTAGACAACTGTGAGGG - Intergenic
951206305 3:19929416-19929438 ATTGGCTTGGCCAGGTGTGGTGG + Intronic
951609059 3:24470902-24470924 AAAGTCTTGGCCGGGTGTGATGG - Intronic
951697567 3:25461605-25461627 ACTGGCTAGGCCAGGTGTGATGG + Intronic
953078549 3:39593892-39593914 AAGGGCTGGGGAAAGTGTGTAGG + Intergenic
953202562 3:40790538-40790560 AAGGGCTTGGCCGGGTGCCATGG + Intergenic
953848337 3:46446233-46446255 ATGTTCTTTGCCAAGTGTGAAGG + Intronic
955866871 3:63393648-63393670 AAGATATTGGCCAAGTGTGGTGG - Intronic
956743281 3:72291519-72291541 AGGGCCTTGGCCAGGTGTGTGGG - Intergenic
959054663 3:101555270-101555292 AAGTGCTTGGCCAGGCATGATGG - Intergenic
960022230 3:112967788-112967810 AAGGGATGGGGCAAGTGTGTGGG - Intronic
960407811 3:117283634-117283656 AAGGACTTGGCCAGGCGTGGTGG + Intergenic
960817283 3:121686984-121687006 AGGGTCTTGGCCAGGTGTGGTGG + Intronic
961782410 3:129328162-129328184 AAGGGCTGGGCCAGATGTGGTGG + Intergenic
962103683 3:132369031-132369053 AAGAACTAGGCCAGGTGTGATGG - Intergenic
962472096 3:135718780-135718802 CAGGCCTTGGCCATGTGTGATGG - Intergenic
962626220 3:137228260-137228282 AAGTGGGTGGCCAAGTGGGAAGG + Intergenic
963191938 3:142482542-142482564 AAGAACTGGGCCAAGAGTGATGG + Intronic
966837483 3:184060074-184060096 GAGTGCTGGGCCCAGTGTGAAGG - Intronic
967847715 3:194057304-194057326 AAGGTCCTGGCCAGGTGTGATGG + Intergenic
968463105 4:735724-735746 AAGACCTTGGCCATGTGTCAGGG - Intronic
968847656 4:3055059-3055081 AAGGGCTTGGCCAGGTGTGGTGG + Intergenic
969879512 4:10161554-10161576 CAAGTATTGGCCAAGTGTGAGGG - Intergenic
970279199 4:14435476-14435498 AAAGAATTAGCCAAGTGTGATGG + Intergenic
971123770 4:23729825-23729847 AATGGCTTTGCCCAGTGTTAGGG - Intergenic
971324744 4:25634685-25634707 AAGGCCTTGGCCAGGTGCAATGG - Intergenic
971835871 4:31762047-31762069 AAGGGTGTAGCCAAGTGTGTAGG + Intergenic
972350354 4:38231008-38231030 AGGGGCCTGGACAAGTGGGAGGG - Intergenic
974358695 4:60846765-60846787 AAGGGCAGGGCCAGGTGTGGTGG - Intergenic
974497218 4:62647469-62647491 ATTGTATTGGCCAAGTGTGATGG - Intergenic
974934020 4:68392225-68392247 AAGGAGTTGGCCAGGTGTGGTGG + Intergenic
976139005 4:81970971-81970993 AAGAGCTTGGAAAAGTGTCATGG - Intronic
976691412 4:87871162-87871184 AAAGGCTTGGCCAGGCGTGGTGG - Intergenic
977538880 4:98290628-98290650 AAAGGCTTGGCAAAGTTTGAAGG + Intronic
980770871 4:137371498-137371520 AATGGCAAGGCCAAGTGTGGTGG + Intergenic
981033039 4:140144880-140144902 AAGGGCTTGAACTAGTGTTAAGG - Intronic
981363787 4:143877761-143877783 ATGGACACGGCCAAGTGTGAAGG + Intronic
981374516 4:143998534-143998556 ATGGACACGGCCAAGTGTGAAGG + Intronic
981540364 4:145840066-145840088 AAGGGCTTGGTGAAATGGGAAGG + Intronic
981780838 4:148427430-148427452 AAGGGGGTGGCCAACTGTGGTGG + Intronic
981944542 4:150325904-150325926 AAGGGCAGGGGCAAGTCTGAAGG + Intronic
982494163 4:156068997-156069019 AAGGGTTTGGCTAAGTGTGGGGG + Intergenic
983729651 4:170977386-170977408 AAGGTCTAGGCCAGGTGTGGTGG - Intergenic
989044192 5:37258304-37258326 ATGGGTTTGGCCAAGTGTGTTGG + Intergenic
990744001 5:58939647-58939669 AAGGTCTTGACCAGGTGTGGTGG - Intergenic
991319203 5:65350497-65350519 AAGGGTCTGACCAAGTGAGAAGG + Intronic
992709958 5:79442452-79442474 AAAGGCTTGTCCTAGAGTGAGGG - Intronic
992770020 5:80038546-80038568 AAGGGCTTGGCTGAGATTGAGGG - Intronic
992802217 5:80303901-80303923 AAGCGGTTGGCCAAGTGCGGTGG + Intergenic
994022494 5:95043834-95043856 AAGGGCTTGGCCTACGGGGATGG + Intronic
996454335 5:123662751-123662773 AATGGCTTGGCCAGGTGCGTTGG + Intergenic
996842968 5:127868594-127868616 AATGCCTTGGCCAGGTGTGATGG + Intergenic
997191710 5:131943828-131943850 TAGAACTTGGCCAGGTGTGATGG + Intronic
997548420 5:134731051-134731073 AAGGGCCTGGCCGGGTGTGGTGG + Intergenic
997944352 5:138185990-138186012 AAGGGCTTGGCTGAGGGTGGTGG - Exonic
998622144 5:143806691-143806713 AAGGACTTTCCCAAGTGGGAGGG - Intergenic
999303168 5:150503555-150503577 AGGGGCTTGGCCTAGTGAGTGGG + Intronic
1001187479 5:169588885-169588907 AAGGGCTTGGTGTAGTGTCATGG - Intronic
1001509594 5:172310302-172310324 AATGTTTTAGCCAAGTGTGATGG + Intergenic
1001703732 5:173726423-173726445 AAAAACTTAGCCAAGTGTGATGG + Intergenic
1001921842 5:175606667-175606689 AATGGCTGGGCCGGGTGTGATGG + Intergenic
1002090918 5:176805618-176805640 AATGTCTTGGCCAGGTGTGGTGG + Intergenic
1002344060 5:178535875-178535897 AGGTGCCTGGCCCAGTGTGAGGG + Intronic
1002641624 5:180633233-180633255 AAGGGTTTGGCCAGGAGAGAGGG - Intronic
1003145596 6:3507874-3507896 AAGGGCGTGGGCAAGTTTTAGGG + Intergenic
1003201444 6:3964977-3964999 AAGGGATTGGCCAGGTGTGGTGG - Intergenic
1003757478 6:9137847-9137869 AAAGGCTTTGCAAGGTGTGAAGG - Intergenic
1004274121 6:14220855-14220877 TCGGGTTTGGCCAGGTGTGATGG - Intergenic
1004742173 6:18472711-18472733 AAGGTGTTGGCCAGGTGTGGGGG + Intergenic
1004825491 6:19415727-19415749 AACTGCTTGGCCAAGTGCGGTGG - Intergenic
1004869750 6:19892963-19892985 AAGTGCTTGGCCAGGTATGGTGG + Intergenic
1005330959 6:24749944-24749966 AAGGTCATGGCCAGGTGTGGTGG + Intergenic
1006384201 6:33720134-33720156 AAGGGCTGGGCGATGGGTGAGGG - Intergenic
1007161986 6:39799041-39799063 TAGGACTTGCCCAGGTGTGATGG + Intronic
1007176491 6:39901293-39901315 AAGGCCTTGGCGAACTGTCAAGG - Exonic
1008101263 6:47393685-47393707 AAGGGCTGGGCCAGGTATGGAGG + Intergenic
1008275006 6:49532862-49532884 AATTGCTTGGCCAGGTGTGGTGG - Intergenic
1008746112 6:54671526-54671548 AAGGACTTGGCCAGGTGTGGTGG + Intergenic
1008837780 6:55858023-55858045 AAGGTGTTGGCCAAGTGTGGTGG - Intronic
1010259327 6:73797009-73797031 AAGGACTTTGGCAAATGTGATGG - Intronic
1010372088 6:75122126-75122148 AAGGACTTGGCCAGGTGCGGTGG - Intronic
1012144883 6:95669063-95669085 AAAAGATTAGCCAAGTGTGAGGG - Intergenic
1012463718 6:99493311-99493333 TAAGGCTTGGCCGAGTGTGGTGG - Intronic
1012968680 6:105703314-105703336 AAGGTCTAGGCCAGGTGTGGTGG - Intergenic
1015488415 6:133798331-133798353 AAGGGATTGGCCAGGTGTGGTGG - Intergenic
1015605941 6:134954746-134954768 AAGGGCATGGCCAAATGCGTGGG + Intergenic
1015903583 6:138092896-138092918 AAGGGCATGGGGAAGTGTGGTGG + Intronic
1016715585 6:147224136-147224158 CAGGGCTTGGCCAGGTGCGATGG + Intronic
1017071797 6:150581565-150581587 AGGGTCTTGGCCAAATGTGGTGG - Intergenic
1017212807 6:151875843-151875865 AAGAGCTTTGCAAACTGTGAAGG + Intronic
1019984426 7:4644923-4644945 CTGGGCTTGGCCGGGTGTGATGG - Intergenic
1020981208 7:15071294-15071316 AAGGGCATGGCCAATAGTGTTGG - Intergenic
1022257907 7:28677718-28677740 AAGGAATTGGCCGAGTGTGGTGG + Intronic
1022650163 7:32267074-32267096 CAGGGCTTGGCCAGGTGGCAGGG - Intronic
1023244628 7:38188188-38188210 AAGGGCTGGGCCTTGTGTGTGGG - Intronic
1023605273 7:41925520-41925542 AAAGGCTTGGTAAAGTGTGAGGG - Intergenic
1023988075 7:45109687-45109709 ACGGGCTTGGCCAGGCGTGGTGG + Intronic
1024075479 7:45815779-45815801 CAGGCCTTGGCCAGGTGTGGTGG + Intergenic
1024077097 7:45826955-45826977 AAAAGCTTAGCCAAGTGTGGTGG + Intergenic
1024097165 7:45991501-45991523 AGGGGCTGGGTCAAGTGTGCTGG - Intergenic
1024155095 7:46614066-46614088 TAATGCTTGGCCAATTGTGATGG + Intergenic
1024606034 7:51023482-51023504 CAGAGCTTGTCCCAGTGTGAGGG - Intronic
1024654958 7:51444253-51444275 AAGAGATAGGCCATGTGTGATGG - Intergenic
1024734846 7:52294497-52294519 AAGGAATTGGCCAGGTGTGCTGG + Intergenic
1025051975 7:55740027-55740049 CAGGCCTTGGCCAGGTGTGGTGG - Intergenic
1025100290 7:56129034-56129056 AAGACCTGGGCCAGGTGTGATGG - Intergenic
1025127320 7:56354465-56354487 AAAAGCTTGGCCAAGTGTGGTGG - Intergenic
1026630141 7:72030897-72030919 AAAAGATTGGCCAAGTGTGATGG - Intronic
1026777365 7:73239113-73239135 ACGTGCCAGGCCAAGTGTGAGGG + Intergenic
1027018215 7:74792485-74792507 ACGTGCCAGGCCAAGTGTGAGGG + Intergenic
1027069812 7:75153433-75153455 ACGTGCCAGGCCAAGTGTGAGGG - Intergenic
1027383920 7:77641537-77641559 AAGGGATTGGCCAGGTGTGGTGG - Intergenic
1027635545 7:80668032-80668054 AAAGCCTTGGCCAGGTGTGGTGG - Intronic
1029162133 7:98560020-98560042 AAGGGCTGGGCAGAGTGTAAAGG + Intergenic
1029367682 7:100127180-100127202 AGGGGCGGGCCCAAGTGTGAAGG + Intronic
1029552740 7:101246184-101246206 CAGGGCTTGGCAGAGAGTGAGGG + Intronic
1030993587 7:116331125-116331147 AAGGACTTGGCAAACTGTAATGG + Intronic
1031014525 7:116558598-116558620 AAAGGATTAGCCAAGTGTGGTGG + Intronic
1032269266 7:130388742-130388764 AATATCTTGGCCAAATGTGATGG - Intergenic
1032531155 7:132621544-132621566 AAGAGATTGGCCAGGTGCGATGG - Intronic
1032856946 7:135842756-135842778 AAGGAATTGGCCAAGAGGGAAGG + Intergenic
1033308107 7:140239535-140239557 CAGGGCTGGGCCAAGGGAGAAGG - Intergenic
1034380321 7:150686654-150686676 AGGATCTTGGCCTAGTGTGATGG + Intronic
1034761790 7:153679411-153679433 GAGGGCTTGGCCATGACTGAAGG + Intergenic
1035731027 8:1853672-1853694 AAGGGCTTGGCCGAGCTTGCGGG + Intronic
1036819311 8:11926957-11926979 AAAATCTTGGCCAAGTGTGGTGG - Intergenic
1036974716 8:13397843-13397865 AAGACCTTGGCCAGGTGTGGTGG + Intronic
1038022950 8:23565305-23565327 AAGCGCTTGCACAGGTGTGATGG - Intronic
1039084609 8:33767393-33767415 AGGGGATAGGCCAAGTGTGGTGG - Intergenic
1039480956 8:37872922-37872944 AGGGGCCAGGCCAAGTCTGAAGG - Exonic
1041037299 8:53807310-53807332 AAGTCCTAGGCCAAGTGTGGTGG + Intronic
1041354046 8:56981277-56981299 AATGTTTTGGCCAAGTGTGGTGG + Intronic
1042369439 8:67974605-67974627 ATTGGGTTGGCCAAGTATGAGGG + Intronic
1042749358 8:72141161-72141183 AAGGGCTGGGAAAAGTGTTAAGG + Intergenic
1043941081 8:86196750-86196772 ATGGGCCTGGCCAAGGGTGGAGG + Intergenic
1044000482 8:86873386-86873408 AGGGTCTTGGCCAGGTGTGGTGG - Intronic
1044437715 8:92185447-92185469 AAAGTCTTGGCCAGGTGTGGTGG - Intergenic
1045026569 8:98092590-98092612 AAGTTCATGGCCAGGTGTGATGG - Intronic
1045984538 8:108234318-108234340 CAGGCCTTGGCCAAGTGCGGTGG - Intronic
1049592503 8:143468973-143468995 GAGGGCTTGGCCACGTGGGCTGG + Intronic
1049641417 8:143717658-143717680 AAGGGGCTGGCCCTGTGTGACGG + Intronic
1051694403 9:19752558-19752580 AAGGAGTTTTCCAAGTGTGATGG - Intronic
1052333488 9:27296011-27296033 ACAGGCTTGGCCAGGTGTGGTGG + Intronic
1052433015 9:28391919-28391941 AACACCTTGGCCAAGTGTGGTGG + Intronic
1053471722 9:38351359-38351381 AAGTGCTAGGCCAGGTGTGGTGG + Intergenic
1053619416 9:39800334-39800356 GAGGGCCTGCCCAAGTGGGAGGG - Intergenic
1053877575 9:42559673-42559695 GAGGGCCTGGCCAAGTGGGAGGG - Intergenic
1053895079 9:42734704-42734726 GAGGGCCTGGCCAAGTGGGAGGG + Intergenic
1054234119 9:62542021-62542043 GAGGGCCTGGCCAAGTGGGAGGG + Intergenic
1054264740 9:62907109-62907131 GAGGGCCTGCCCAAGTGGGAGGG + Intergenic
1054751324 9:68910088-68910110 ACAGGCTTGGTCAACTGTGAAGG - Intronic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1058919148 9:109596793-109596815 ATGAGCTTGGCCAGGTGTGGTGG + Intergenic
1059171284 9:112127492-112127514 AAGGACTTTGCTCAGTGTGAGGG - Intronic
1059430302 9:114245955-114245977 AAGGGCTTGGCACAGAGTAAGGG - Intronic
1059471859 9:114511094-114511116 AAGAGCTTGGCCGGGTGTGCTGG + Intergenic
1059668570 9:116472482-116472504 AAGAGCTTTGCCCAGTGTTAGGG - Intronic
1060611803 9:124973408-124973430 ATGTGCTTGGCCAGGTGTGGTGG + Intronic
1061576152 9:131507839-131507861 CAGGCCTTGGCCAATTGAGATGG + Intronic
1061695150 9:132367889-132367911 GAGGGCTTGCCCAGGTCTGAAGG - Intergenic
1062335323 9:136062762-136062784 AAAGACTTAGCCAAGTGTGGTGG + Intronic
1062431153 9:136527421-136527443 CAGGGCTTGGCCGAGTGAGGTGG + Intronic
1185462952 X:340730-340752 GAGGGCATGGCCCAGGGTGAGGG - Intronic
1186928238 X:14358880-14358902 AAGCCCTTGGCCAGGTGTGGTGG + Intergenic
1187193932 X:17063090-17063112 AAGGGCTTAGCCAAGTGCTTAGG + Intronic
1187373141 X:18726947-18726969 ACAAGCTTGGCCAAGTGCGATGG - Intronic
1188577612 X:31671197-31671219 AAGGTATTGGCCAGGTGTGGTGG - Intronic
1189838721 X:45048007-45048029 AAAAGATTAGCCAAGTGTGATGG + Intronic
1190777212 X:53562497-53562519 TAGGACTTGGCCAAGTCTGCTGG + Intronic
1195856350 X:109336771-109336793 AAAGGCCAGGCCAACTGTGAAGG - Intergenic
1197272481 X:124440386-124440408 AAGCACTTGGAAAAGTGTGAAGG - Intronic
1198576108 X:138011864-138011886 AAGGGCATGGCCAGGTGTTTTGG + Intergenic
1199096268 X:143744212-143744234 AAGGGAATAGCCAACTGTGAAGG + Intergenic
1199312824 X:146341421-146341443 AGGGGGTTGGCCAGGTGTGGTGG - Intergenic
1200228569 X:154432706-154432728 AAGGGCCTGGCTAGGTGAGAAGG - Intronic