ID: 944692222

View in Genome Browser
Species Human (GRCh38)
Location 2:202168687-202168709
Sequence CACTGAATGCAGAGGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 369}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944692222_944692226 3 Left 944692222 2:202168687-202168709 CCTTCCAGCCTCTGCATTCAGTG 0: 1
1: 0
2: 2
3: 30
4: 369
Right 944692226 2:202168713-202168735 TTACTGTGACATAACTCCTTGGG 0: 1
1: 0
2: 0
3: 6
4: 99
944692222_944692225 2 Left 944692222 2:202168687-202168709 CCTTCCAGCCTCTGCATTCAGTG 0: 1
1: 0
2: 2
3: 30
4: 369
Right 944692225 2:202168712-202168734 GTTACTGTGACATAACTCCTTGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944692222 Original CRISPR CACTGAATGCAGAGGCTGGA AGG (reversed) Intronic
900302507 1:1985227-1985249 CGGTGAATGCAGTGGTTGGAAGG - Intronic
902199801 1:14824890-14824912 CACTAAATGTAGAGCCTAGAAGG - Intronic
902507850 1:16949327-16949349 CCCTGAGTTCAGAGACTGGATGG - Intronic
903489243 1:23715377-23715399 AACTGAATGCAGAGGGGGAAAGG - Intergenic
904287481 1:29461646-29461668 CACAGAATGCTGGGGCTGGCAGG + Intergenic
904999565 1:34657665-34657687 CCCAGAGTGCAGAGGCTGAAGGG + Intergenic
905005507 1:34706475-34706497 CAGTGAATCCAGAGGCAAGAAGG + Intergenic
906679190 1:47713639-47713661 GACTGAGAGCAGAGGCAGGATGG + Intergenic
906810818 1:48825287-48825309 AACTGACTCCAGAGGCTGGTTGG - Intronic
907161498 1:52373523-52373545 CACAAAATGCAGAGGCAGAATGG + Intronic
907635048 1:56125664-56125686 CACTGAATGAATATTCTGGATGG - Intergenic
907900164 1:58733852-58733874 CACTGAAGGCAGACCCTGGCAGG - Intergenic
913202629 1:116508194-116508216 CACTGAATGCTCAGGCCAGAAGG - Intergenic
913659621 1:120994657-120994679 CACTGAATGCTGAAACTGCAGGG + Intergenic
913978233 1:143482863-143482885 CACTGAAAGCTGAGGCTGAGAGG + Intergenic
914010982 1:143777781-143777803 CACTGAATGCTGAAACTGCAGGG + Intergenic
914072639 1:144308492-144308514 CACTGAAAGCTGAGGCTGAGAGG + Intergenic
914106515 1:144657864-144657886 CACTGAAAGCTGAGGCTGAGAGG - Intergenic
914166849 1:145183331-145183353 CACTGAATGCTGAAACTGCAGGG - Intergenic
914649603 1:149686441-149686463 CACTGAATGCTGAAACTGCAGGG + Intergenic
915141760 1:153772446-153772468 CACTGGACGCCGAGGGTGGAAGG - Intronic
915245342 1:154552300-154552322 CCCTGAATGAAAATGCTGGATGG + Intronic
915874100 1:159594152-159594174 CACAGACTGCAGAAGGTGGATGG + Intergenic
916979155 1:170114957-170114979 CACCGAAGGCAGAGTCTGGATGG + Intergenic
919944374 1:202308888-202308910 CATTGAATGCCGAGGGAGGAGGG - Intronic
920206626 1:204296846-204296868 CACAGAGTACTGAGGCTGGAAGG - Intronic
920248428 1:204605772-204605794 CACTGGAGGCAGAGGATGTACGG + Intergenic
920534602 1:206729429-206729451 GATTGAATGCAGATACTGGATGG - Exonic
921365213 1:214367345-214367367 CACTGAAAGCAGAGAGTAGAAGG - Intronic
922372493 1:224925305-224925327 CACTGCCTGCAGAGGCTCCAAGG - Intronic
922698418 1:227743509-227743531 CACGCAATGCAGAGGCAGCAAGG - Intronic
922732698 1:227959507-227959529 CACTGAAGGTAGAGGCTGGGAGG + Intergenic
923291611 1:232551620-232551642 CTCTGTCTGCGGAGGCTGGAGGG - Intronic
1062970392 10:1643709-1643731 AGCTGCATGCGGAGGCTGGAAGG - Intronic
1064996352 10:21299927-21299949 CACTGATGGCAGAGGTAGGAAGG + Intergenic
1065972346 10:30815619-30815641 CTGTGAAAGCAGAGGCTCGAGGG - Intergenic
1068952354 10:62790109-62790131 CACTGAATGCACAGTGAGGAGGG + Intergenic
1069094360 10:64240655-64240677 CACTGAATGGAGGGACTGGCTGG + Intergenic
1069558754 10:69415097-69415119 AGCTGAAAGCCGAGGCTGGAAGG + Exonic
1069915019 10:71782065-71782087 CACTGCAGCCTGAGGCTGGAAGG + Intronic
1069985588 10:72280747-72280769 CTCTGAATGTAGAGGTTGGTGGG + Intergenic
1070324426 10:75378568-75378590 CTCTGAATGATGAGGATGGATGG - Intergenic
1070769379 10:79073460-79073482 CACTGAAGGCAGAGGCTTCCAGG - Intronic
1071212146 10:83355646-83355668 CACTGAGTCCAGAGGCAGTAGGG + Intergenic
1071495776 10:86166923-86166945 TCCTGAATGCAAAGGCAGGAAGG - Intronic
1071497463 10:86178915-86178937 CAGGCATTGCAGAGGCTGGAGGG + Intronic
1072475502 10:95756175-95756197 CACAGCAAGCAGAGGCTGGGGGG + Intronic
1073915238 10:108396008-108396030 AACTGTATGCTGAGGCTGCATGG + Intergenic
1074894610 10:117764115-117764137 TACTGAAGGCAGAGGCTCCATGG + Intergenic
1075125909 10:119698658-119698680 CACTCACAGCAGGGGCTGGAGGG + Intergenic
1075341226 10:121648236-121648258 CAGTGACTGCAGAGGAGGGATGG - Intergenic
1075599781 10:123758962-123758984 CACTGAAGGCAGAGGCAAAATGG + Intronic
1076025270 10:127107063-127107085 CTTTGAAGGCAGAGGCGGGAGGG - Intronic
1076195969 10:128518471-128518493 GACTGAACACAGAGCCTGGAAGG - Intergenic
1076668913 10:132108459-132108481 TACTGGAAGCAGGGGCTGGAGGG + Intronic
1077021346 11:418453-418475 CATGGAAGGCAGAGGCTGGGTGG - Exonic
1077532494 11:3103768-3103790 AAGGGACTGCAGAGGCTGGAAGG - Intronic
1077956993 11:7031301-7031323 CACAGAATGTGGACGCTGGATGG - Intronic
1078039652 11:7848084-7848106 CAATGAATGCACAGGCTGGTAGG - Intergenic
1078149491 11:8746574-8746596 GAGTGAATGCAGAGGAGGGAGGG + Intronic
1078260469 11:9702099-9702121 AACAGAATGCAGAGGCTGCTAGG - Intronic
1078648243 11:13162772-13162794 CTTATAATGCAGAGGCTGGAAGG - Intergenic
1079094789 11:17503204-17503226 CAGTGAATGCACAGGCAAGAAGG + Intronic
1081827426 11:46070404-46070426 CCCTGGAGGCAGAGGCTGCAGGG - Intronic
1082203803 11:49406028-49406050 CACTGAAAGTAAAGCCTGGAGGG + Intergenic
1082263914 11:50099240-50099262 CACTGAATGGTGAGGGTGGGTGG + Intergenic
1083244469 11:61415750-61415772 CACTCACTGTAGAGGGTGGAGGG + Exonic
1083327006 11:61878003-61878025 TACAGACTGCAGAGGCTGGGAGG + Intronic
1084060217 11:66667813-66667835 CTCAGAATGCTGAGGTTGGAAGG - Intronic
1084565573 11:69926603-69926625 CACTGACTCCTGGGGCTGGAGGG + Intergenic
1084794357 11:71495174-71495196 CACTGAATGCAGTGCTAGGAGGG - Intronic
1085473178 11:76771220-76771242 GACAGAAAGCAGAGGGTGGAAGG - Intergenic
1085757418 11:79213188-79213210 CAGTGTATGTGGAGGCTGGATGG + Intronic
1087910953 11:103752836-103752858 CACTTACTGCAGAGGCTCTATGG - Intergenic
1088617123 11:111642124-111642146 CACCAAATGCGGAGGGTGGAGGG + Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1091452065 12:578659-578681 CACAGAATCCAGAGCCTGGCTGG - Intronic
1092377542 12:7968307-7968329 CTCTGAAGGCAGAGGCAGGAAGG + Intergenic
1093645343 12:21579727-21579749 CAATGAAAGCAGAGGTTGAAGGG - Intronic
1093888997 12:24497048-24497070 CACTGAATGATGAGGCTGCAAGG + Intergenic
1095461847 12:42452353-42452375 CACAGAACACTGAGGCTGGAAGG - Intronic
1095709794 12:45276061-45276083 CACAGAGCGCAGAGGCAGGATGG - Intronic
1096070195 12:48771088-48771110 CACTGATAGCAGCAGCTGGAAGG - Intronic
1096140296 12:49237382-49237404 CACTCATTGCCCAGGCTGGAGGG - Intronic
1096346459 12:50851227-50851249 CACAGAATTCAGAATCTGGATGG + Intronic
1097146249 12:56941319-56941341 AACTGAATGCACAGGCTTGCGGG - Intergenic
1097151966 12:56985796-56985818 AACTGAATGCACAGGCTTGCGGG - Intergenic
1097431617 12:59515349-59515371 CACTGAATGTAGAGGAGGGAAGG + Intergenic
1097793668 12:63841284-63841306 AAGAGAAAGCAGAGGCTGGAAGG - Intergenic
1098777083 12:74634430-74634452 CATAGAATTCAGAGACTGGATGG - Intergenic
1098808956 12:75059439-75059461 CATTGAATGCAGAAGCAGGTAGG + Intronic
1098920674 12:76299431-76299453 CACAGAATGAAGAGGGTGCAAGG + Intergenic
1100675997 12:96868774-96868796 CAGTGAATGCAAAGGATGAATGG - Intronic
1101438816 12:104687452-104687474 TACTTAATGCAGTGGTTGGACGG - Intronic
1101550097 12:105753471-105753493 CTCAGAATCCAGAGGCTGGCAGG + Intergenic
1101888052 12:108686322-108686344 AAATGAATGCAGAGGCTGAAAGG + Intronic
1103577772 12:121891218-121891240 CCCTGAATGTTGAGGCTGCAGGG + Intronic
1104398793 12:128458761-128458783 AACTGAATGTGGAGTCTGGAAGG + Intronic
1105213602 13:18272090-18272112 CACTCACTGCACAGCCTGGAAGG - Intergenic
1106842506 13:33699472-33699494 CCGTGATTGCAGGGGCTGGATGG - Intergenic
1107378359 13:39829217-39829239 TGATGAAAGCAGAGGCTGGAGGG - Intergenic
1107814436 13:44231779-44231801 CACTGAATGCAGTTGCGGCATGG + Intergenic
1109158416 13:58940839-58940861 CAGTGAATGCAGAGGCCTAAGGG - Intergenic
1109651881 13:65337429-65337451 CACAGAATTCAGAATCTGGATGG + Intergenic
1110966977 13:81712602-81712624 CATGGAATTCAGAGTCTGGATGG - Intergenic
1112521519 13:100099675-100099697 CCCTGTTTGCAGTGGCTGGAAGG + Intronic
1114539916 14:23447439-23447461 TTCTCATTGCAGAGGCTGGAAGG - Intergenic
1114863036 14:26550619-26550641 CACTGAATCAAAAGGCTGTAAGG + Intronic
1114962245 14:27908061-27908083 AATTGAATGGAGAAGCTGGAGGG + Intergenic
1115532554 14:34340660-34340682 AAATGAATGAAGTGGCTGGATGG - Intronic
1116739669 14:48738446-48738468 GCCTGACTACAGAGGCTGGATGG - Intergenic
1118277885 14:64401909-64401931 GACTGAATGCAGAGGCAGATAGG - Intronic
1119177516 14:72580103-72580125 CACTGAATTAAGAGGTTGGATGG - Intergenic
1119570570 14:75667713-75667735 CTCTGAATGCACAGTCTGTAAGG - Intronic
1119918672 14:78426181-78426203 AAATGAGAGCAGAGGCTGGAGGG + Intronic
1120376458 14:83713942-83713964 CAGTGAAGGCAGAGGATGGTGGG - Intergenic
1120723388 14:87911719-87911741 CCCTGAAGGCAGACTCTGGAAGG - Intronic
1121434246 14:93908552-93908574 GACTGAATGGACAGGTTGGATGG - Intergenic
1121452063 14:94014986-94015008 CACTGAATTCAGAGGGAGGTTGG + Intergenic
1122060453 14:99133627-99133649 CGCTGAGTGCAGAGGGTGGGTGG - Intergenic
1122251544 14:100443466-100443488 CACGGAAAGCAGAGAATGGAGGG - Intronic
1122405110 14:101496272-101496294 AACAGCATGCAGAGGCTGCAGGG + Intergenic
1124830537 15:33144998-33145020 CCCTGATTGCAGTTGCTGGAAGG - Intronic
1124925338 15:34064995-34065017 CTCAGAATCCAGAGTCTGGAAGG + Exonic
1126785056 15:52171525-52171547 CAGTGAATGCAGAGAAAGGAAGG + Intronic
1127569111 15:60223583-60223605 CCCAGAATGCAGAGGGTTGAGGG - Intergenic
1127784955 15:62347696-62347718 AACTGCATGAGGAGGCTGGAAGG + Intergenic
1129057007 15:72827202-72827224 GACTGAAAGCAGAGGCTGTAAGG - Intergenic
1129172867 15:73818440-73818462 CAGTGAATGCAGAGTGTGGTTGG - Intergenic
1131307553 15:91258745-91258767 CACGGACTGCAAATGCTGGATGG + Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1132080566 15:98861402-98861424 CGCTGCATGCAGAGGGTGTAAGG - Intronic
1132180692 15:99750632-99750654 CACTGAATCCACATGTTGGAGGG - Intergenic
1132180703 15:99750679-99750701 CACTGAATCCACATGTTGGAGGG - Intergenic
1132180714 15:99750726-99750748 CACTGAATCCACATGTTGGAGGG - Intergenic
1132396623 15:101479579-101479601 CGGTGCATGCAGAGGCTGGTGGG + Intronic
1132461530 16:57716-57738 CCCTAAAGGCTGAGGCTGGAGGG - Intergenic
1133028399 16:2998439-2998461 CACTGGGGGCAGAGGCTAGAAGG - Intergenic
1133235678 16:4386366-4386388 CACTGGGGGCAGAGCCTGGAAGG + Intronic
1134788562 16:16967220-16967242 TACTGAACCCTGAGGCTGGAGGG + Intergenic
1137785876 16:51137377-51137399 TACTGATTCCAGAAGCTGGAAGG + Exonic
1138121564 16:54404514-54404536 CACTGAATTCTGAATCTGGAGGG + Intergenic
1138343188 16:56304143-56304165 CACAGAACACAGAGGCTGGTGGG + Intronic
1138401128 16:56745227-56745249 CACGGAGTGCAAAGGCTGTAAGG + Intronic
1138585906 16:57970371-57970393 TACTGAGTGCAGGGGCTGGGCGG - Intronic
1142088325 16:88196541-88196563 AACTCAATGGAGTGGCTGGAGGG - Intergenic
1142158524 16:88545081-88545103 CAATGTCTGCAGTGGCTGGAGGG + Intergenic
1142285596 16:89170294-89170316 CACTGACCACAGAGGCAGGATGG + Intergenic
1142624516 17:1183314-1183336 GTCTGAGTGCACAGGCTGGAGGG - Intronic
1143468476 17:7155399-7155421 CACTGAATGCATAACCTGTATGG - Intergenic
1143619513 17:8073022-8073044 CACTGAAACCAAAGGGTGGAGGG - Intronic
1144930603 17:18855977-18855999 CACTGGCTTCAGAGGGTGGAGGG + Intronic
1145915881 17:28573797-28573819 CATTGAGTGCAGAGGCTTGCAGG + Exonic
1146659896 17:34658797-34658819 CCCTGGATGCAGAGGCTACAGGG - Intergenic
1146687204 17:34849162-34849184 CACTGAATGGTCAGGTTGGAGGG - Intergenic
1150207167 17:63417796-63417818 CACTGACTACAGAGACTAGAGGG - Intronic
1150266923 17:63837930-63837952 CACAGCATGCTGGGGCTGGAAGG - Intronic
1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG + Intronic
1151892453 17:76958669-76958691 CTCTGAAGGCAGAGGGTGGGTGG + Intergenic
1152343517 17:79738071-79738093 CCCAGAAGGCAGAGGCGGGAGGG + Intronic
1152702520 17:81826063-81826085 CACTGGAGGCAGAGGATGCATGG - Exonic
1153083412 18:1255284-1255306 CACTTAATCAAGAGCCTGGAAGG + Intergenic
1153579977 18:6562963-6562985 CCCAGAAGGCAGAGGCTGCAGGG + Intronic
1153795430 18:8617694-8617716 AACAAAAGGCAGAGGCTGGAAGG - Intronic
1154140650 18:11821722-11821744 CACTGTTTGCAGAGGCAGGTGGG + Intronic
1155318331 18:24594094-24594116 CACTTAAAGAAGAGGCAGGAAGG + Intergenic
1156360261 18:36378489-36378511 CACAGAGTGCAGAGGCTGACAGG - Intronic
1157267498 18:46240170-46240192 AGCTGAATGCAGAGGCAGGTTGG + Exonic
1159458608 18:68694122-68694144 CACTGAATGGAGGGACTGAAGGG + Intronic
1159574427 18:70157633-70157655 GACAGAATTCAGAAGCTGGAAGG + Intronic
1159802323 18:72916880-72916902 CACAGAATTCAGAATCTGGATGG - Intergenic
1160956494 19:1694895-1694917 CTCTGAAGGCTGATGCTGGAGGG + Intergenic
1161673016 19:5624577-5624599 CACTGCCTGCAGGGGCTGGGGGG - Intronic
1162434385 19:10648438-10648460 CAATGAATAGAGAGGCTGTAAGG + Intergenic
1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG + Intronic
1162599796 19:11659352-11659374 CACAGAAGGCAGAGGTTGCAGGG - Intergenic
1163010952 19:14425765-14425787 CCCAGACTGCAAAGGCTGGAGGG - Intergenic
1163687045 19:18717637-18717659 CACTGTAGGCTGAGACTGGAAGG - Intronic
1164047999 19:21559325-21559347 CACAGGAGGCAGAGGCTGCAGGG - Intergenic
1165825526 19:38703645-38703667 CACTGGATCCAGTGCCTGGAAGG - Intronic
1167776653 19:51562795-51562817 GGCTGAATGAAGAGGCAGGAAGG + Intergenic
925082234 2:1079286-1079308 CACAGAAAGCAGTGCCTGGAGGG + Intronic
927198020 2:20561267-20561289 CACTGCATGCAGAGCCCTGAGGG + Intronic
927267853 2:21173015-21173037 CACAGAATGCAAAAGCTGTAGGG - Intergenic
927576449 2:24205572-24205594 TACTGGATGCAGAGGAGGGAAGG - Intronic
928204431 2:29273867-29273889 CACTGAATGGAGAAGTTAGAAGG + Intronic
928409173 2:31041169-31041191 CACTCACTGCAGATGCTAGAAGG + Intronic
928786957 2:34899655-34899677 GACTGAAGGCAGAGGCAAGAGGG - Intergenic
930233373 2:48865307-48865329 CAGTCAAAGGAGAGGCTGGAGGG + Intergenic
930680829 2:54255489-54255511 CCGTGAATGCAGAGGCTGACAGG - Exonic
931901317 2:66791540-66791562 CACTGAATGCAGAGGGAAGTTGG + Intergenic
932070115 2:68611736-68611758 CACTCATTGCAGAGAGTGGAGGG + Intronic
932553831 2:72799987-72800009 CCCTGGAGGCAGAGGCTGCAGGG + Intronic
932776413 2:74530538-74530560 CACTGAAGCCACAGGCTGGAGGG + Intronic
933431069 2:82179994-82180016 AACTGAAATCAGAGTCTGGAAGG - Intergenic
934053530 2:88231711-88231733 CAGTGGAGGCAGAGGCTGGTGGG + Intergenic
934182942 2:89643871-89643893 CACTGAAGGCTGAGGCTGAGAGG + Intergenic
934293230 2:91718060-91718082 CACTGAAAGCTGAGGCTGAGAGG + Intergenic
934300727 2:91774656-91774678 CACTCACTGCACAGCCTGGAAGG + Intergenic
935954813 2:108365446-108365468 CACTGAATGCTGAGATTGAATGG - Intergenic
936607768 2:113975208-113975230 AACTGAATGCTGCGGCTGGCCGG + Intergenic
937827520 2:126382748-126382770 CACTGAACGCAGAGTTGGGAAGG - Intergenic
937966524 2:127515763-127515785 CACTGAATTGTGAGGTTGGAAGG - Intronic
938104411 2:128520348-128520370 CACGCCAAGCAGAGGCTGGAAGG + Intergenic
939308351 2:140438122-140438144 CTCTGGAGGCTGAGGCTGGAGGG - Intronic
939928303 2:148201223-148201245 CAGTGAATGCAGGGTCTGGCTGG + Intronic
940794254 2:158060445-158060467 CATTCAAAGCAGAGGCAGGATGG - Intronic
941958468 2:171229284-171229306 CACTGAATGTTGAGGCTGTGTGG - Intronic
944681853 2:202084394-202084416 CTCTGAATGCAGAGGCATGAAGG - Intronic
944692222 2:202168687-202168709 CACTGAATGCAGAGGCTGGAAGG - Intronic
944877431 2:203976297-203976319 CAATGAAAGCAGGGGTTGGAGGG + Intergenic
945658769 2:212658877-212658899 CACAGAATTCAGAATCTGGATGG - Intergenic
947251514 2:228110709-228110731 GACTGAATGCAGAGGCAGCTAGG + Intronic
948180968 2:235979938-235979960 TACTGCATGCAGAGGCAGCAAGG - Intronic
948628173 2:239283493-239283515 CACTGCCGGCAGAGGCTAGAAGG + Intronic
949005196 2:241642139-241642161 TAATGAATGCAGAGGCTGCTGGG + Intronic
949078814 2:242080214-242080236 CACTGAATGAGGAGGCGGGAAGG - Intergenic
1169878007 20:10318640-10318662 CAATGAAAGCAGAAGCTGAAAGG - Intergenic
1172101506 20:32486415-32486437 CAATGTCTTCAGAGGCTGGAGGG - Intronic
1174106191 20:48164009-48164031 CACTGAAGGCGGGGGCTTGATGG + Intergenic
1175451461 20:59072344-59072366 CAATGGAGGCAGAGGCTGGAGGG + Intergenic
1175882711 20:62270127-62270149 CACTGCATGCGCAGGGTGGACGG - Intronic
1177844993 21:26279005-26279027 CAGTGAGGGCAGATGCTGGAGGG - Intergenic
1178291350 21:31371312-31371334 CCCAGAATGCAAAGGCAGGAAGG + Intronic
1178423040 21:32457294-32457316 CACTGAGTGCCGAGGCTCCAGGG - Intronic
1179964486 21:44793527-44793549 AAATGAGTTCAGAGGCTGGAGGG + Intronic
1180030560 21:45203700-45203722 CACTGAATGCACAGGCAGGTAGG - Intronic
1180816435 22:18792481-18792503 CACTCACTGCACAGCCTGGAAGG - Intergenic
1180869044 22:19135920-19135942 CACAGGAGGCTGAGGCTGGAAGG + Intronic
1180917588 22:19499687-19499709 CTCAGAATGCAGATGCTGCAGGG + Intronic
1181202622 22:21226813-21226835 CACTCACTGCACAGCCTGGAAGG - Intronic
1181439671 22:22929209-22929231 CACTGAATCCAGGGGCAAGAAGG + Intergenic
1181699081 22:24609792-24609814 CACTCACTGCACAGCCTGGAAGG + Intronic
1181775940 22:25160345-25160367 CTCTGAATGAGGGGGCTGGATGG - Intronic
1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG + Intergenic
1184208103 22:43018016-43018038 GACTGAAGGAGGAGGCTGGATGG - Intergenic
1184307563 22:43616769-43616791 CAGTAAAGGCTGAGGCTGGAGGG + Intronic
1185104028 22:48857346-48857368 CACTGTAGGAAGAGGCAGGAAGG - Intergenic
1185161744 22:49234156-49234178 CACTGAAGAAACAGGCTGGATGG - Intergenic
1203224291 22_KI270731v1_random:68600-68622 CACTCACTGCACAGCCTGGAAGG + Intergenic
1203266535 22_KI270734v1_random:18192-18214 CACTCACTGCACAGCCTGGAAGG - Intergenic
950980123 3:17294642-17294664 CATTGCATGCAGTGACTGGATGG - Intronic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
951813073 3:26722791-26722813 CACTGCATTCGGAGCCTGGAGGG + Intergenic
952494625 3:33904968-33904990 GACTGAAAGGAGAGGCTGGAGGG + Intergenic
952964314 3:38611615-38611637 CACTGAATTAACAGGCTGGGTGG + Intronic
953561498 3:43996456-43996478 CGCTGAAGGCAAAGGCTGGTGGG + Intergenic
953582896 3:44173180-44173202 CAGTGAATGGTGAAGCTGGATGG - Intergenic
954238036 3:49272039-49272061 CACTGAAGTCACAGGCTGGCAGG + Intronic
954408894 3:50360857-50360879 CACTGAAATCAGTGGCTGAAAGG - Intronic
954534681 3:51350686-51350708 CACTGGAGGCAGAAGTTGGAAGG - Intronic
954873572 3:53785877-53785899 CACAACTTGCAGAGGCTGGAAGG - Intronic
955596916 3:60601031-60601053 CCCTGCCAGCAGAGGCTGGAAGG + Intronic
955777312 3:62447708-62447730 GACTGCCTGCAGAGGCTGGTGGG + Intronic
955874955 3:63479031-63479053 CACAGAATGCTGAAGCTGAAGGG - Intronic
957626891 3:82664635-82664657 CGCTGACTGCTCAGGCTGGAGGG + Intergenic
959810469 3:110613256-110613278 CACAGAATGCAGAAGCTAGGAGG + Intergenic
961142543 3:124567388-124567410 CACAGAAGGCAGAGGAGGGAAGG - Intronic
961633426 3:128317986-128318008 CACTCCAGGCAGAGGCAGGATGG + Intronic
962458020 3:135583108-135583130 CAGTGACAGCAGAGGCTGGGTGG - Intergenic
962854525 3:139331778-139331800 CACTGAATGTCTAGGATGGAGGG - Intronic
962931477 3:140041578-140041600 TACAGAATACAAAGGCTGGAAGG - Intronic
963715938 3:148804033-148804055 TACTGAATTCAGAGGGTGGCTGG + Intronic
966190472 3:177267845-177267867 CTCAGAATGCAGAGGTTGGGAGG - Intergenic
966746897 3:183285626-183285648 TTTTGAATGCAGGGGCTGGAAGG - Intronic
967441205 3:189511194-189511216 CACTGAATGGAAAAGCTAGAAGG + Intergenic
968076853 3:195820693-195820715 CGATGGAGGCAGAGGCTGGAGGG - Intergenic
969112212 4:4851191-4851213 CACCTCATGCAGAGGCTAGAAGG + Intergenic
969660842 4:8526571-8526593 CGCTGAATAAGGAGGCTGGAGGG - Intergenic
969728320 4:8938946-8938968 GACAGAATCCAGAGGCTAGAGGG - Intergenic
970431206 4:15990617-15990639 CACTCAGAGCAGAGGGTGGAAGG + Intronic
972823248 4:42726702-42726724 CCCTGAAGGCAGAGGTTGCAGGG - Intergenic
975623070 4:76314182-76314204 TGCTGAATGCAGTGTCTGGATGG - Intronic
980302868 4:131016128-131016150 TACTGGATGCAGTGACTGGATGG + Intergenic
982600401 4:157442684-157442706 CACAGAATTCAGAATCTGGATGG - Intergenic
983283798 4:165714280-165714302 CACTGACTGTAGAGGATGTAAGG - Intergenic
985474972 5:73849-73871 CCCTGAAAGCAGAGGATCGAGGG - Intergenic
985679365 5:1247912-1247934 AAGTGATTGCAGAGCCTGGAGGG + Intergenic
985836130 5:2273184-2273206 CACCGCATGCAGAGGGTGGAGGG - Intergenic
985967832 5:3351192-3351214 AACAGAAGGAAGAGGCTGGAGGG - Intergenic
986253326 5:6081275-6081297 CAGAGAATGGAGAGGCTGGGAGG - Intergenic
986271137 5:6232387-6232409 CACTGAGTGGAGAAGATGGAGGG + Intergenic
986271177 5:6232545-6232567 CACTGAGTGGAGAAGATGGAGGG + Intergenic
986271196 5:6232620-6232642 CACTGAGTGGAGAAGATGGAGGG + Intergenic
986271215 5:6232695-6232717 CACTGAGTGGAGAAGATGGAGGG + Intergenic
986271234 5:6232770-6232792 CACTGAGTGGAGAAGATGGAGGG + Intergenic
986443025 5:7797956-7797978 CACTGAATGCAGGTGCTGATGGG + Intronic
986708034 5:10467536-10467558 TACTGAATCCACAGGCTGCAAGG + Intronic
987977420 5:25032714-25032736 CGCAGAATTCAGAAGCTGGATGG - Intergenic
988140422 5:27232224-27232246 CCCTGGAGGCAGAGGCTGCAAGG - Intergenic
992465792 5:77002755-77002777 CCCTGGAGGCAGAGGCTGTAGGG + Intergenic
996039229 5:118792003-118792025 CAATGAATTCAAAGGCCGGAAGG - Intergenic
998162645 5:139822237-139822259 AGCTGAATCCCGAGGCTGGAGGG - Intronic
998639320 5:143991790-143991812 GACTAGATCCAGAGGCTGGAAGG + Intergenic
998846020 5:146310791-146310813 CAGTGAATCCAAGGGCTGGATGG + Intronic
1001482551 5:172098493-172098515 CACAGGATGCAGAGGAAGGATGG + Intronic
1001869694 5:175140646-175140668 CACTGAGTGCAGAACCAGGATGG + Intergenic
1001899807 5:175417200-175417222 CACAGAGTGAAGAGGTTGGATGG - Intergenic
1002195974 5:177501542-177501564 CACAGAATGCAAAGCCTGGAGGG - Intergenic
1002709420 5:181185659-181185681 AACTGAAAGAACAGGCTGGAGGG + Intergenic
1002875015 6:1202798-1202820 CACTAAATGCAGAGGCACGGAGG - Intergenic
1003712301 6:8605483-8605505 GACTGAAGGCACAGGCTGGCTGG - Intergenic
1005130819 6:22505678-22505700 CTCTGAATGCAGAGGCATCAAGG - Intergenic
1006810078 6:36814602-36814624 CACAGAATGCAGAGGCCAGCAGG + Intronic
1006915663 6:37592198-37592220 CACTGAGGTCAGAGCCTGGAGGG + Intergenic
1007365946 6:41393058-41393080 AGCTGAATGCAGAGGCTAGATGG - Intergenic
1007855744 6:44854638-44854660 CACTGAGTGCAGAAGCTGAATGG - Intronic
1010189152 6:73176685-73176707 TACTGATTGGAGAGGATGGAGGG + Intronic
1010277468 6:73986485-73986507 CACTGAAGGTAGAGGCTGAAGGG - Intergenic
1011093825 6:83636629-83636651 CACAGAATTCAGAATCTGGATGG - Intronic
1011772844 6:90694063-90694085 CACTCAGTACTGAGGCTGGAGGG - Intergenic
1012425903 6:99114189-99114211 CACTGTCTGCAGAGGCTCTAAGG + Intergenic
1012490730 6:99780181-99780203 CACTGGAAGCAGAGGCAGGGTGG + Intergenic
1012603883 6:101132908-101132930 CTCTGATTGCATAGGCTGAAGGG - Intergenic
1012670696 6:102043435-102043457 AACAGAAAGCAGAGGCTGGAGGG - Intronic
1014852619 6:126360884-126360906 CACAGAATTCAGAATCTGGATGG - Intergenic
1015211936 6:130708564-130708586 CACTCATTGCAGAAGGTGGAGGG + Intergenic
1015378113 6:132533869-132533891 CCCTGAATGGAGAGACTGGCTGG + Intergenic
1015751792 6:136567651-136567673 CACTGAATGTACAGCTTGGAAGG - Exonic
1015842369 6:137489016-137489038 CACTGAAAACAGACGCTCGACGG + Intergenic
1017148464 6:151256134-151256156 CACTGAATAATGAGGCAGGAAGG + Intronic
1018429664 6:163713294-163713316 CACAGAAACCTGAGGCTGGAGGG - Intergenic
1018963454 6:168465241-168465263 CACAGAAAGCAGCGGCAGGATGG - Intronic
1019024528 6:168948052-168948074 CTCTGACTGGAGTGGCTGGAAGG - Intergenic
1019293126 7:260061-260083 CAGTGAATTCAGAGGCAGGACGG + Exonic
1019337018 7:490222-490244 CTCAGAAGGCTGAGGCTGGAAGG + Intergenic
1019980711 7:4619941-4619963 CAGAGAATGCAGAGGATGGCGGG + Intergenic
1020131525 7:5561443-5561465 CACGGGAGGCAGAGGCTGCAGGG + Intronic
1020263204 7:6543071-6543093 CTCTGAGAGCAGAGGATGGAAGG - Intronic
1021190910 7:17618724-17618746 AACTGAAAGAAAAGGCTGGAAGG + Intergenic
1021272956 7:18614782-18614804 CACTGAATTCAGATTCTGGAGGG - Intronic
1021345268 7:19519651-19519673 CACAGAATGAAGGGGCAGGAGGG + Intergenic
1021909353 7:25368730-25368752 CGCTGAATGCACAGGCAGCAGGG + Intergenic
1022168284 7:27795626-27795648 CCCAGAAGGCAGAGGCTGCAGGG - Intronic
1022477920 7:30723805-30723827 CAATGAGGGCAGGGGCTGGAGGG + Intronic
1022507684 7:30916697-30916719 CACTGAAAGGAGCTGCTGGAAGG - Intronic
1022509742 7:30927433-30927455 CACTAAACCCACAGGCTGGAAGG - Intergenic
1023150527 7:37197483-37197505 CACTGAATTCAGAGGTAGGAAGG + Intronic
1024452627 7:49564732-49564754 CATAGAATGCAGAATCTGGATGG + Intergenic
1026979680 7:74519087-74519109 CAGGCAATGCAGAGGCAGGAAGG + Intronic
1027172564 7:75883105-75883127 GACTGACTGCAGTGGCTAGAAGG + Intronic
1028577024 7:92363475-92363497 CAGGGCATGCAGAGGCTAGAGGG + Intronic
1029133630 7:98352564-98352586 CCCTGGAGGCAGAGGCTGCAGGG + Intronic
1033536461 7:142316796-142316818 CACAGAATTCTGAGGCTGGAAGG + Intergenic
1034449095 7:151127959-151127981 CGCTGAACGCAGAGGCTGGATGG - Intronic
1034798308 7:154033458-154033480 CACTGAATTTAAATGCTGGACGG - Intronic
1034846563 7:154451566-154451588 AACTGAATGTAGATGCTGGCAGG - Intronic
1034969307 7:155409202-155409224 AACTGACTGCCGAGGCCGGAGGG + Intergenic
1035537078 8:400234-400256 CAATGAATGAGGAGGCGGGAAGG - Intergenic
1035731196 8:1854515-1854537 CAGTGTTTGCAGAGGATGGAGGG + Intronic
1036213833 8:6863366-6863388 CAGGGAGTGGAGAGGCTGGAGGG + Intergenic
1037107600 8:15128515-15128537 GACTAAATGGAGAGTCTGGAGGG - Intronic
1037188486 8:16093421-16093443 TAATGAGTGGAGAGGCTGGAAGG - Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1037856657 8:22376203-22376225 CACTCAGTGCACAGGCTGGAGGG + Intronic
1038309857 8:26438025-26438047 AAGTGAAAGCAGGGGCTGGAAGG + Intronic
1038672434 8:29592995-29593017 CTCAGAAGGCAGAGGCTGCAGGG + Intergenic
1039397714 8:37241196-37241218 AACAGAGAGCAGAGGCTGGAAGG - Intergenic
1039558094 8:38491273-38491295 TACTGAATGCACAGACTGGGTGG + Intergenic
1039843476 8:41309440-41309462 CACTGACTCCGGAGGCTGCAGGG + Exonic
1040468454 8:47716692-47716714 CACTGACTGCAGAGGGTGGGTGG + Intronic
1041190546 8:55349473-55349495 CAGAGGATGCAGAAGCTGGAGGG - Intronic
1041851492 8:62398169-62398191 AACTAAAAGCAGAGGCTGCAGGG + Intronic
1042937127 8:74070693-74070715 AACTGATTCCAGAGGCAGGATGG - Intergenic
1044302115 8:90596740-90596762 CACTGCAGGCTGAGGATGGAAGG + Intergenic
1048267222 8:132998326-132998348 CACTGAAAGCAGTGGCTGCAAGG + Intronic
1048375311 8:133817967-133817989 CACTGAATGCAGGGACTGTCAGG - Intergenic
1048517547 8:135124494-135124516 CAGTGTATGCAAAAGCTGGAAGG + Intergenic
1048592516 8:135833917-135833939 GAATGAATGGAGAGGATGGATGG - Intergenic
1048902907 8:139056938-139056960 CTCAGAAGGGAGAGGCTGGAAGG - Intergenic
1049678215 8:143902968-143902990 CTCTGAGGACAGAGGCTGGATGG - Intergenic
1050684215 9:8148475-8148497 CACAGAATTCAGAATCTGGATGG + Intergenic
1051885807 9:21891311-21891333 CATTGAATTCAGAATCTGGATGG + Intronic
1055131443 9:72779435-72779457 CATAGAATTCAGAGTCTGGATGG + Intronic
1057048074 9:91901039-91901061 GACTGAATCCAGAGCCAGGAAGG + Intronic
1059642044 9:116226898-116226920 CACAGAATGTCAAGGCTGGATGG + Intronic
1060233126 9:121840342-121840364 CGATGGATGCACAGGCTGGAGGG + Intronic
1060349485 9:122845816-122845838 TAGTGAATGAAGAGGCTTGATGG - Exonic
1060989325 9:127839136-127839158 CACTGAAGGTAGAGGAGGGAGGG - Intronic
1061593414 9:131613463-131613485 CTCTGACTGCAGAGGCAGGAAGG + Intronic
1061933490 9:133845244-133845266 GACTGAATCCACGGGCTGGATGG + Intronic
1203759685 EBV:5700-5722 CAGTGTATGCATAGTCTGGAAGG - Intergenic
1185433467 X:23220-23242 GATTGAAAGCAGAGTCTGGAAGG + Intergenic
1185442673 X:235288-235310 GATTGAAAGCAGAGTCTGGAAGG + Intergenic
1186396138 X:9211090-9211112 CACTGATCTAAGAGGCTGGATGG + Intergenic
1187799284 X:23042453-23042475 CAATCAATGGAGAGGCTGAAAGG + Intergenic
1188242411 X:27808608-27808630 GGCTTAAGGCAGAGGCTGGACGG - Intronic
1188440761 X:30213885-30213907 CCCTGAATGAAGATGATGGAAGG + Intergenic
1189566084 X:42242594-42242616 CCCTGAAAGCAGAGCCTGCAAGG + Intergenic
1192291770 X:69804735-69804757 CACAGAATTCAGAGTTTGGAAGG - Intronic
1193736197 X:85159715-85159737 AACTGCATGCAGTTGCTGGAGGG + Intergenic
1194503938 X:94709554-94709576 CAATGAAGGCAGAGGGTGAAAGG + Intergenic
1195580534 X:106496123-106496145 CACTGAAAGCAGAGTTGGGAAGG - Intergenic
1195614847 X:106903960-106903982 CACTTACTGCTGAGGCTGGAGGG - Intronic
1195931175 X:110078422-110078444 CACAGAATTCAGAATCTGGATGG - Intronic
1196873468 X:120135565-120135587 CACACCATGCAGGGGCTGGAAGG - Intergenic
1198586467 X:138127887-138127909 CACAGAATTCAGAATCTGGATGG - Intergenic
1199943684 X:152648988-152649010 AACTGAATGCAGAGACGGAAAGG - Intronic
1200098256 X:153674103-153674125 CGGTGAAGGCAGAGACTGGAAGG - Exonic
1200251050 X:154553964-154553986 CACTGAACACACAGCCTGGAAGG - Intronic
1201349347 Y:13022851-13022873 CACAGAATTCAGAGTCTAGATGG - Intergenic
1201984458 Y:19950475-19950497 AACTGAGGGCAGAGGGTGGAAGG - Intergenic