ID: 944696294

View in Genome Browser
Species Human (GRCh38)
Location 2:202203109-202203131
Sequence CTGGATTTACGTGGTTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944696294_944696302 29 Left 944696294 2:202203109-202203131 CCTTCAGAACCACGTAAATCCAG No data
Right 944696302 2:202203161-202203183 TTCAGTCTGAAACACTAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944696294 Original CRISPR CTGGATTTACGTGGTTCTGA AGG (reversed) Intergenic
No off target data available for this crispr