ID: 944696473

View in Genome Browser
Species Human (GRCh38)
Location 2:202205038-202205060
Sequence GGGACCTTGAATAACATTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944696473 Original CRISPR GGGACCTTGAATAACATTTA GGG (reversed) Intergenic
902109058 1:14062796-14062818 GGGACATTTAATAGAATTTAGGG + Intergenic
907534866 1:55142328-55142350 GTGGCCTTTAATAACATTTATGG + Intronic
909044177 1:70689293-70689315 AGGACCTTGGATAACACTGAAGG + Intergenic
917520512 1:175744266-175744288 GTGACCTTGATGCACATTTATGG + Intergenic
919297671 1:195722665-195722687 GGGGCCTTGGAGAACCTTTATGG - Intergenic
920217859 1:204374299-204374321 GGGACCTTGAAGAAGATTCTAGG - Intronic
920652450 1:207848955-207848977 GGGACTTTGAATAAGTTTTGTGG + Intergenic
921429352 1:215045713-215045735 GGCATCTTGAATAACTATTAAGG - Intronic
921437149 1:215136878-215136900 TGGATATTGAATAACATTAAAGG - Intronic
923389293 1:233498175-233498197 GGCACCTTGAGTAAGACTTATGG + Intergenic
923624060 1:235599787-235599809 GGGGCTGTGAATAACATTAAGGG - Intronic
924578651 1:245303496-245303518 AGGATCTTTAAGAACATTTAGGG - Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1069383556 10:67864110-67864132 GGTATCTTGATTAACATTAAAGG - Intergenic
1069499946 10:68942996-68943018 GGGACATGGAACAACATATAGGG + Intronic
1069761400 10:70814148-70814170 GGGACCTCGAATATCCTTTTTGG - Intergenic
1074259792 10:111840394-111840416 GGCACCTTGAGCAAGATTTACGG + Intergenic
1074475384 10:113769175-113769197 TGCACCTTGAATAACAATGATGG - Intronic
1078572031 11:12467658-12467680 GGGAGCTTTAATAACTTTCAAGG + Intronic
1079821704 11:25139782-25139804 TGGACCTGGATTAGCATTTAGGG - Intergenic
1088599339 11:111461428-111461450 GGGAGCTTGAAGAAAATGTATGG + Intergenic
1092174751 12:6395724-6395746 GGCACCTGGAGTAAGATTTATGG - Intergenic
1093295599 12:17386776-17386798 GGGACCTTGAATAAAGATGAGGG - Intergenic
1094449596 12:30570907-30570929 GTAACCTTCACTAACATTTATGG + Intergenic
1096811729 12:54174769-54174791 GGGTCCTTGAATGAGATGTAGGG + Intronic
1100424976 12:94475762-94475784 TGGACCTTGAAAAAACTTTACGG + Intergenic
1101665002 12:106804774-106804796 CTGACCTTGAATTATATTTATGG - Intronic
1103353299 12:120300777-120300799 GGGACCTTGAAGACCACCTAAGG - Intergenic
1107308855 13:39054152-39054174 GGGATTTTGGTTAACATTTATGG + Intergenic
1108112276 13:47087889-47087911 GGGTCCTTGGAGACCATTTAAGG + Intergenic
1109319711 13:60795424-60795446 TGGACCTTAAAGAACTTTTATGG + Intergenic
1110778633 13:79439105-79439127 GGAAACTTTAATTACATTTATGG - Intergenic
1113446972 13:110376759-110376781 GGGGCCTTGAATTACAAGTAGGG - Intronic
1115443665 14:33464586-33464608 GGGATCTTGAATAATGTTGAAGG + Intronic
1116237901 14:42304650-42304672 GGGCACTTTAATAACATTTACGG + Intergenic
1119187714 14:72654733-72654755 GGGAACTGGAATAACCTTTTGGG - Intronic
1119970080 14:78960405-78960427 GGGGCCTTAAAGAACATTAAAGG - Intronic
1120144577 14:80965751-80965773 TGAACCTTTAAGAACATTTAGGG + Intronic
1124210649 15:27762356-27762378 GGCTCCTTGAATAAGATTTATGG - Intronic
1130795412 15:87203478-87203500 GGGACCTGGAATAGCAGTGATGG - Intergenic
1131576603 15:93598520-93598542 AGGACATTGAATAAGATTAAGGG - Intergenic
1135131968 16:19860540-19860562 GGGATCTGGAATAACACATAAGG + Exonic
1140689444 16:77467595-77467617 TGGACCTTGAATAAATTGTATGG - Intergenic
1155192956 18:23447536-23447558 GGGGCCAGGAATAACATTTTGGG - Intergenic
1155235341 18:23812879-23812901 GGCATCTTGAATGACATTTATGG - Intronic
1155767413 18:29652880-29652902 GGGCCCTTGGATGGCATTTATGG + Intergenic
1156248147 18:35323076-35323098 GGTGCCTTGAGTAAGATTTATGG - Intergenic
1159092006 18:63860428-63860450 TGGACCTTCAATATCATTTCTGG - Intergenic
1160898821 19:1416521-1416543 GGAAGCTTGAATGACATCTAAGG + Intronic
927533380 2:23832258-23832280 GGGACCTTAAAAACTATTTAAGG + Intronic
928749643 2:34457125-34457147 TGGACCTTGAGTAACATTGGTGG - Intergenic
929162229 2:38843886-38843908 GGGGCTTTGAGCAACATTTAAGG - Intronic
931650089 2:64460384-64460406 GGCACCTTGAAATACATTTGTGG + Exonic
932135331 2:69224035-69224057 GGGCCCCTGAGTAGCATTTAAGG + Intronic
935480533 2:103582543-103582565 GGGACTTTTATCAACATTTAAGG + Intergenic
941770836 2:169343965-169343987 GGCATCTTGAATAACTTTTGAGG - Intronic
944696473 2:202205038-202205060 GGGACCTTGAATAACATTTAGGG - Intergenic
945716549 2:213365008-213365030 AGGGCCTTGAGAAACATTTAGGG + Intronic
946120129 2:217504219-217504241 GAGACCTGGAATATCTTTTATGG + Intronic
1171566067 20:26189543-26189565 GGAAGCTTTAATATCATTTATGG - Intergenic
1172545467 20:35757486-35757508 AGGACCTTGACTAATATATAAGG + Intergenic
1176658946 21:9615409-9615431 GAGACCAGGAATAAAATTTAAGG + Intergenic
1178185186 21:30210251-30210273 CGTACCTTGAATTACAATTAGGG - Intergenic
1179909071 21:44438520-44438542 GGGACTTTGAATGACAAATAGGG + Intronic
950646616 3:14381234-14381256 GGTACAATGAATAAAATTTAAGG + Intergenic
950951073 3:16999547-16999569 GGTACCATAAATAACATTTGGGG + Intronic
956430924 3:69185601-69185623 GGGACCATGAATAACTTCTTTGG - Intronic
956501995 3:69896928-69896950 GGAAACTTGAATAACAAGTAGGG + Intronic
956675347 3:71726702-71726724 GTGACCTTGATTACCTTTTAGGG - Intronic
958603864 3:96332979-96333001 GGTACCTTGAGTAAGGTTTATGG - Intergenic
958632995 3:96704452-96704474 AGGCCCTTGAACAGCATTTATGG - Intergenic
963505180 3:146176036-146176058 GGGGCCTTTAATAATTTTTAGGG - Intergenic
965904848 3:173691134-173691156 GGAACTTGAAATAACATTTAGGG + Intronic
969670680 4:8588379-8588401 GGGACATTCAATGACATTGATGG - Intronic
972029514 4:34436069-34436091 GGAAGCTTTAATATCATTTATGG - Intergenic
973621387 4:52729640-52729662 GACACCTTTAATTACATTTAGGG - Intronic
974864521 4:67563745-67563767 GGAACCTTGAATAACCTCTGTGG - Intronic
979225761 4:118282462-118282484 GGAATAATGAATAACATTTATGG + Intronic
980092226 4:128454949-128454971 GGGACCTGGAGGAACAGTTAGGG - Intergenic
980400245 4:132274908-132274930 GGAACCTTGATTAATTTTTAGGG + Intergenic
981014065 4:139955133-139955155 GGGACTCTGAGTAACATTGAGGG - Intronic
981122376 4:141067564-141067586 GGGTACTTTGATAACATTTAGGG + Intronic
984844080 4:184095311-184095333 GGGACCTTGTTTAAAATTTGGGG + Intronic
985416381 4:189740024-189740046 GAGACCAGGAATAAAATTTAAGG - Intergenic
986482084 5:8199787-8199809 GGGACCCTAAATCACATTGAGGG - Intergenic
986501335 5:8402970-8402992 GGGACCCTGAAGAACATTTTCGG - Intergenic
988204950 5:28122391-28122413 GGAACCTTGACTAATATATAAGG - Intergenic
991626787 5:68611012-68611034 AGGGCCCTGAATAACATTCATGG - Intergenic
994783933 5:104130784-104130806 GGGATGTTGAATATCATTTGTGG + Intergenic
995583424 5:113623270-113623292 GGGACCTTGACTCAGATTTTGGG - Intergenic
997486161 5:134232575-134232597 GGGCCCTTGAGTAACATTGCAGG - Intergenic
999218429 5:149955350-149955372 GGGACGCTGTATAACCTTTAAGG - Intergenic
999930421 5:156426666-156426688 GTTATCTTGAAGAACATTTATGG + Intronic
1003123983 6:3340618-3340640 GGGACCTTGAAAATCGTTTTTGG - Intronic
1007334766 6:41147393-41147415 GGGACCTGAAATAACTTTTTTGG - Intergenic
1007677568 6:43609839-43609861 GACACCATGAAAAACATTTAGGG + Intronic
1008723647 6:54390132-54390154 GGGAACTTTAAAGACATTTAGGG - Exonic
1008749226 6:54711753-54711775 GGGACCTAGAATAACTATTGAGG - Intergenic
1010111227 6:72235867-72235889 GGAAAATTGAATAAAATTTAGGG + Intronic
1011679697 6:89771055-89771077 GGTGCTTTGAATAAGATTTATGG - Intronic
1011992474 6:93540210-93540232 GGGATGTTGAATTACATTGAAGG - Intergenic
1013182936 6:107733188-107733210 GGGGCTTAAAATAACATTTAGGG - Intronic
1016173542 6:141050058-141050080 GGGACTTTGAATAACCTAAATGG - Intergenic
1016890164 6:148998157-148998179 GGGGCCATAAATAACTTTTATGG + Intronic
1017765492 6:157603742-157603764 GGGTCCTGGAAAAACATTTGAGG - Intronic
1018270411 6:162071347-162071369 GGTACTTTGAATAACAATAAAGG - Intronic
1020700193 7:11472253-11472275 TTGACCTTGAATAAGATTTGGGG - Intronic
1021488653 7:21194230-21194252 GGGACATTGAAAAAAATTCAGGG + Intergenic
1022338608 7:29447020-29447042 GCGAAGTTGAAGAACATTTATGG + Intronic
1025271416 7:57522475-57522497 GGAAGCTTTAATATCATTTATGG + Intergenic
1027649523 7:80848482-80848504 TGGACATTGAATAACACTGAAGG + Intronic
1028483180 7:91330324-91330346 GGGCCCTTCATTAATATTTATGG + Intergenic
1031461274 7:122052447-122052469 GTGACCTTCATTAACATTTAAGG + Intronic
1033526669 7:142222034-142222056 TGGAACTTGAGTAGCATTTATGG - Intronic
1034690237 7:153008065-153008087 GGGACTTTGAGTACCAATTATGG - Intergenic
1034884970 7:154792420-154792442 GAGACGTTGAATTATATTTAAGG + Intronic
1037276208 8:17182606-17182628 TGGATTTTGAATTACATTTAGGG + Intronic
1040665350 8:49624875-49624897 GGGAGTTTGAACAACATTTTTGG + Intergenic
1042604050 8:70528405-70528427 AGGACCTTGAATACCATGCAAGG + Intergenic
1043107266 8:76129931-76129953 AGGACATTAAATAACATGTAAGG - Intergenic
1044189951 8:89304068-89304090 GGAAACATAAATAACATTTAAGG + Intergenic
1045894212 8:107194748-107194770 AGAACCTTGAATGATATTTAAGG - Intergenic
1048671280 8:136724337-136724359 GGGACCTAGACTAACACATAGGG - Intergenic
1051463489 9:17350786-17350808 GGGACTTTGAGTAGCAATTAGGG - Intronic
1052388805 9:27854378-27854400 TGGAATTGGAATAACATTTATGG - Intergenic
1053611615 9:39719369-39719391 AGGACATTAAATAACATGTAGGG + Intergenic
1054086640 9:60751791-60751813 AGGACATTAAATAACATGTAGGG - Intergenic
1054241906 9:62623020-62623042 AGGACATTAAATAACATGTAGGG - Intergenic
1054556030 9:66657534-66657556 AGGACATTAAATAACATGTAGGG - Intergenic
1056259520 9:84833876-84833898 GGGAACTTTAACAACATTGATGG - Intronic
1059253810 9:112910533-112910555 GGGATGATGAATATCATTTATGG + Intergenic
1060702347 9:125767640-125767662 GACACCTTGAATATCATTCATGG + Intronic
1062650468 9:137574084-137574106 GGGATCTTGAAGACCTTTTATGG - Intronic
1203636692 Un_KI270750v1:119017-119039 GAGACCAGGAATAAAATTTAAGG + Intergenic
1186282474 X:8008141-8008163 GGGCCCATGTATAACATTTCAGG - Intergenic
1188345924 X:29065393-29065415 GGGAACTTCAATAACTTTAAGGG - Intronic
1189578624 X:42382384-42382406 GTAACATTTAATAACATTTATGG + Intergenic
1193733164 X:85126036-85126058 GGGATCTTCAAGATCATTTAGGG - Intergenic
1194509057 X:94769708-94769730 GGGAAGTTGAATGACATGTATGG + Intergenic
1194617650 X:96126727-96126749 ATGACCTAAAATAACATTTAAGG + Intergenic
1195864535 X:109415005-109415027 GGGACATTGAATACCAAGTAGGG + Intronic
1196499080 X:116357368-116357390 GAGACTTTGACTAACATATAAGG - Intergenic
1197348511 X:125353619-125353641 GGGACCTTGTATGGCATATATGG + Intergenic