ID: 944714422

View in Genome Browser
Species Human (GRCh38)
Location 2:202364579-202364601
Sequence AATTGTACACACATACAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944714418_944714422 27 Left 944714418 2:202364529-202364551 CCTGCCTGATTTATATTTTTCCA No data
Right 944714422 2:202364579-202364601 AATTGTACACACATACAGCTGGG No data
944714420_944714422 7 Left 944714420 2:202364549-202364571 CCAGAATTTTCTAAGTATATGTT No data
Right 944714422 2:202364579-202364601 AATTGTACACACATACAGCTGGG No data
944714419_944714422 23 Left 944714419 2:202364533-202364555 CCTGATTTATATTTTTCCAGAAT No data
Right 944714422 2:202364579-202364601 AATTGTACACACATACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944714422 Original CRISPR AATTGTACACACATACAGCT GGG Intergenic
No off target data available for this crispr