ID: 944721993

View in Genome Browser
Species Human (GRCh38)
Location 2:202432961-202432983
Sequence CCACCTTACCAGCTGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944721993 Original CRISPR CCACCTTACCAGCTGGCAGA TGG (reversed) Intronic
900594574 1:3474847-3474869 CCACCCTACCCGATGGCATAGGG + Intronic
901022684 1:6263014-6263036 CACCCTTCCCAGCTAGCAGAAGG - Intergenic
901489603 1:9589796-9589818 CCACCTTTCCAGAGGGCAGGGGG + Intronic
902316139 1:15620029-15620051 TAACTTTACCAACTGGCAGAGGG - Intronic
903669419 1:25026673-25026695 CCACCCTCCCAGCTGGCATGAGG - Intergenic
904205811 1:28854594-28854616 CAACCTCACCAGCTCGCACAGGG - Intronic
907240731 1:53079539-53079561 CCACCTCACCAGTCTGCAGAGGG + Intronic
908484131 1:64573327-64573349 CCTCCTTCCTAGCTTGCAGATGG - Intronic
909581345 1:77239270-77239292 CCTCCTGACCAGCTGGTATACGG - Intergenic
909595992 1:77406611-77406633 CCATCTTACCAGGTGGCATATGG - Intronic
912505935 1:110156126-110156148 CCAAATTACTAGCAGGCAGATGG - Intronic
914989123 1:152483006-152483028 CCACCTCTCCAGCTGGGTGAAGG - Intergenic
916237170 1:162602173-162602195 CCACACCACCAGCTTGCAGAGGG - Intergenic
919662250 1:200258685-200258707 CCACCTTCACTGCAGGCAGAAGG + Intergenic
919997105 1:202762301-202762323 CCAACTTCCCAGCTAGCAAAGGG - Intronic
923023864 1:230188938-230188960 CCAGCCAGCCAGCTGGCAGAAGG + Intronic
923633224 1:235669418-235669440 CCACGTTTTCTGCTGGCAGATGG + Intronic
923773545 1:236958734-236958756 CCTCACTACCAGCTGACAGAGGG - Intergenic
1063229675 10:4052144-4052166 GAACCTTACCAGCTGGAGGAAGG - Intergenic
1063626044 10:7691035-7691057 CTCCCTTCCCAGCTTGCAGATGG - Intergenic
1065864556 10:29902833-29902855 CTACCTTCTCAGCTTGCAGATGG - Intergenic
1067080330 10:43208929-43208951 CCACCTTCCCAGCTGTGAAATGG + Intronic
1069313352 10:67066802-67066824 CTAGCTTACCATCTAGCAGAAGG + Intronic
1069652815 10:70063052-70063074 CCACCTTGCTGGCTGGCAGAGGG + Intronic
1069912195 10:71766371-71766393 CCTCCTTACCTGGTGGCAGGTGG - Intronic
1076425865 10:130367206-130367228 CCACCTCATCACATGGCAGAGGG - Intergenic
1077092588 11:786487-786509 CCCCCACACCAGCTGGAAGAAGG + Intergenic
1078654251 11:13223340-13223362 CCACCTCAGCTGCAGGCAGAGGG - Intergenic
1079363693 11:19791267-19791289 CCACCTCACCAGCTGCCAAATGG + Intronic
1080246612 11:30186204-30186226 ACCCCTTACCACATGGCAGAAGG + Intergenic
1081827236 11:46067678-46067700 CCACCTTACCAGCTTTCTGAGGG + Intronic
1083172527 11:60931422-60931444 CCACCTTGCCAGGTGGGAGGTGG + Intronic
1083201970 11:61126143-61126165 CCAACCTGCCAGCGGGCAGAAGG + Intronic
1083262434 11:61530543-61530565 CGACCTGACCCACTGGCAGAGGG + Intronic
1083581131 11:63826360-63826382 CCACCTTACCAGTATGGAGAAGG - Intronic
1084670394 11:70603389-70603411 CCATCTTCCCAGCTGCCCGAAGG + Intronic
1086431334 11:86739780-86739802 CCACCTTACCATCTGACTGCAGG + Intergenic
1089156694 11:116408125-116408147 CCAGGTCACCAGCTTGCAGAAGG + Intergenic
1089159128 11:116424222-116424244 CCTCCTTAAAAGCTGGCAGCTGG + Intergenic
1091315931 11:134614072-134614094 CCTCCTTACCACAAGGCAGATGG - Intergenic
1091991217 12:4957485-4957507 CCACCTTGCCGGCTGGTAGCAGG + Intergenic
1100982331 12:100171540-100171562 CTAAATTACAAGCTGGCAGAAGG - Intergenic
1101546153 12:105714930-105714952 CCACCTCACCAGCTTTAAGATGG - Intergenic
1102640133 12:114360184-114360206 CCACCTTCCCAACTTGCTGAAGG - Intronic
1103290856 12:119845164-119845186 CCATCTTGCAAGATGGCAGATGG + Intronic
1103801619 12:123541616-123541638 CCACATTTCCAGCTGTCAGCTGG + Intergenic
1105790791 13:23796768-23796790 CCACTGTACCAGCTTGGAGATGG - Intronic
1106136219 13:26975694-26975716 CCACCCTACCCGCTGATAGAAGG + Intergenic
1106347637 13:28894420-28894442 CCCCCTTCCCGGCTTGCAGATGG - Intronic
1106870214 13:34011333-34011355 CCCCAGAACCAGCTGGCAGAGGG + Intergenic
1109459621 13:62638750-62638772 CCACCCTACAATCTGGGAGAAGG - Intergenic
1110099107 13:71573409-71573431 CCATCGTACCATTTGGCAGAAGG + Exonic
1114204342 14:20554624-20554646 CCAGCTTCCCAGCTTGCAGATGG - Intergenic
1118302865 14:64630761-64630783 CCACATTAGCAGGTGGAAGAGGG + Intergenic
1119780058 14:77271282-77271304 CCACCATAGCGGCTGGCGGAGGG - Exonic
1121639042 14:95473061-95473083 CCCTCTTACCAGCTGGCAACAGG + Intronic
1121810659 14:96885901-96885923 CCATCTTCCCAGTTTGCAGACGG - Intronic
1124118979 15:26872320-26872342 CCTCCTTCCCAGCTAGAAGATGG - Intronic
1128694280 15:69748640-69748662 CCCCCAAACCAGATGGCAGATGG + Intergenic
1130746163 15:86656222-86656244 CCATCTTAACAAGTGGCAGAGGG + Intronic
1132269608 15:100512259-100512281 CTTCCTGACCAGCTGGCAAAGGG - Intronic
1134087078 16:11364801-11364823 CCAGTTTACCATCTGGAAGAAGG - Intronic
1134746855 16:16595181-16595203 CCTTCATACAAGCTGGCAGATGG - Intergenic
1134880933 16:17745101-17745123 CCTCCTCACCATCAGGCAGAGGG + Intergenic
1134998619 16:18758482-18758504 CCTTCATACAAGCTGGCAGATGG + Intergenic
1136984003 16:35083180-35083202 CCTGCTTGCCAGCAGGCAGATGG + Intergenic
1138545990 16:57720110-57720132 CCACCTCACCAGGTGGCTGTGGG - Intronic
1139985785 16:70897511-70897533 CCACCTTGTCATCTGTCAGAGGG - Intronic
1141512802 16:84523739-84523761 CCTCCCTGCCAACTGGCAGAGGG - Intronic
1141749295 16:85947546-85947568 CCACCTCACCAGGTTGCAGAGGG - Intergenic
1142426045 16:90002865-90002887 CCACCTTCCCTTCTGGCAGAGGG - Intergenic
1142850913 17:2704353-2704375 CCATCTTACCTGCAGGGAGAAGG + Exonic
1143349556 17:6277382-6277404 CCTCCTTGCCAGCTGCCAGAGGG + Intergenic
1145283608 17:21487189-21487211 GGACCTGACAAGCTGGCAGAAGG + Intergenic
1145393846 17:22478313-22478335 GGACCTGACGAGCTGGCAGAAGG - Intergenic
1145878955 17:28340223-28340245 CCACCTGACAAGCTGGCGGCAGG - Intronic
1146233507 17:31134768-31134790 CCACATTACAAGCAGCCAGATGG - Intronic
1147309712 17:39588020-39588042 CCACCTTCCCTGGGGGCAGAAGG + Intergenic
1147383853 17:40070693-40070715 CCACCCTAGCAGCAGGCAGAGGG + Intronic
1150211695 17:63445617-63445639 CCACCTTGACACCTGGGAGATGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151951084 17:77354514-77354536 CCTCCTTTCCAGCTGGGGGAGGG + Intronic
1152209969 17:78997890-78997912 CCACGTTGCCAGCTGGGACAGGG - Exonic
1153300337 18:3586571-3586593 CCACCTATTCAGCAGGCAGAGGG - Intronic
1156137000 18:34053535-34053557 CCCCCTTATCTGCTGGAAGATGG + Intronic
1160535604 18:79589849-79589871 CCCCTCTCCCAGCTGGCAGAGGG - Intergenic
1160993573 19:1871709-1871731 CCACCTTCCCACCTGGCTGGTGG - Intergenic
1166161486 19:40956855-40956877 CCACCTTGCCATCTGGCAATGGG - Intergenic
1166177856 19:41087638-41087660 TCATGTTACCAGTTGGCAGAGGG - Intergenic
1167027441 19:46931302-46931324 CCATCTTCCCAGCTGATAGAAGG + Intronic
1168311150 19:55461453-55461475 CGACCTTACCGCCTAGCAGATGG - Intronic
1168426992 19:56246720-56246742 CCACCACACCTGCTGGAAGAAGG - Exonic
1168450841 19:56465575-56465597 CCACCTTCCCATCTGGAAAACGG - Intronic
926382644 2:12305644-12305666 CCAGCTTTCCTGCTGGGAGAGGG + Intergenic
932887815 2:75562718-75562740 CCAGCTTTCCAGCAGGCATATGG + Intronic
935098751 2:99972062-99972084 CCAGCTGACCATCTGCCAGATGG + Intronic
939009761 2:136832282-136832304 CCAGCTCTCCAGCTTGCAGATGG - Intronic
939198550 2:139004141-139004163 CAAGCTTATCATCTGGCAGATGG + Intergenic
944721993 2:202432961-202432983 CCACCTTACCAGCTGGCAGATGG - Intronic
944722005 2:202433079-202433101 CTACCTTACCAGCTGGCAGATGG - Intronic
945987016 2:216363059-216363081 CCAGCATACCAGCTGGAAAAGGG + Intronic
948201305 2:236131278-236131300 CCAAATTCCAAGCTGGCAGAAGG - Exonic
948510245 2:238459097-238459119 CTTCCTTGCCAGCTGGCACAGGG - Intergenic
948693895 2:239723062-239723084 CCTGCTTTCCAGCTGGCAGAAGG + Intergenic
1169956415 20:11108149-11108171 CAACCTTACAAGCTGACAGCTGG + Intergenic
1172222920 20:33286055-33286077 CCATCTTCCCAGGTGTCAGAGGG - Exonic
1172740200 20:37160677-37160699 CCAATTTACAAACTGGCAGAGGG + Intronic
1174418393 20:50383124-50383146 CCACATTACAGGCTGGAAGAGGG + Intergenic
1175440976 20:58991097-58991119 TCACCTTACCAGCTGACATTGGG - Intronic
1179366265 21:40760850-40760872 CTACCTTCCCAGCTGGGACAGGG + Intronic
1182593996 22:31403803-31403825 GCACCTGACCAGCTGGAAAAAGG - Intronic
1184374300 22:44102074-44102096 CCAGCTTTCTAGCTTGCAGATGG - Intronic
1185020172 22:48369886-48369908 CCACCTTCCCAAGAGGCAGAGGG - Intergenic
950037017 3:9893514-9893536 CCACCTCAGCAGATGGCAAAAGG - Exonic
951766778 3:26208427-26208449 GGACCTGACAAGCTGGCAGAAGG + Intergenic
954425930 3:50443115-50443137 CCAGCATACCAGCTGGCACGGGG + Intronic
954694036 3:52410751-52410773 CCACCCTCCCAGCTGTCTGAGGG - Exonic
959158496 3:102695732-102695754 GGACCTGACAAGCTGGCAGAAGG - Intergenic
960054211 3:113265063-113265085 CCAACTGAGCAGCTGTCAGAGGG + Intronic
960637477 3:119797412-119797434 CCACCTAAACAGCTTGAAGAAGG - Intronic
963441153 3:145342269-145342291 GGAGCTTACAAGCTGGCAGAGGG + Intergenic
965708150 3:171530393-171530415 CCAGCTTCCCTGCTTGCAGATGG - Intergenic
967865548 3:194187104-194187126 TCTCCTTACCAGCTGTCAGCTGG - Intergenic
968915905 4:3496974-3496996 CCACATTCCCTGCTGGCAGTGGG - Intronic
969075223 4:4572840-4572862 CCACCTGACCAGCTGAAAGGAGG + Intergenic
970793346 4:19886085-19886107 CCAGTTTTCCAGCTTGCAGATGG + Intergenic
971935608 4:33143498-33143520 CCACCTGATCAGCTGCCAGTAGG - Intergenic
972258645 4:37385653-37385675 CCACCTTAACACCAGGCTGAGGG + Intronic
972539165 4:40024196-40024218 CCACCTCAGCAGCTGGTACAGGG - Intergenic
976008564 4:80459758-80459780 GGACCTAACAAGCTGGCAGAAGG - Intronic
980067067 4:128201308-128201330 CCATCTTAGAGGCTGGCAGAAGG + Intronic
982156261 4:152524414-152524436 CCACCATACCTGCTAGGAGAAGG - Intronic
982665613 4:158258272-158258294 CCACCTTATCAGTTTGCAAAGGG - Intergenic
984755855 4:183324933-183324955 CCACCTCATCAGCTGGCAACAGG + Intergenic
988854914 5:35219048-35219070 CCACCTTGGCAGATGGCAGGTGG + Intronic
989296642 5:39835453-39835475 CCCCATTACCAGCGGGCAAATGG + Intergenic
989541944 5:42628127-42628149 CCAGCTGACCAGCAGACAGATGG - Intronic
990982595 5:61615413-61615435 CTGCCTTACCAGGGGGCAGAGGG - Intergenic
992212183 5:74491762-74491784 TCATCTTTCCAGCTGCCAGATGG + Intergenic
997159246 5:131589797-131589819 CCCCCTTACCAGGATGCAGATGG - Intronic
998063168 5:139135192-139135214 CCACCTTGCCAGCTGGGGGCTGG - Intronic
1002204449 5:177553530-177553552 CCAGCTTGCCACCTGGAAGAAGG - Intronic
1002607212 5:180390470-180390492 CCACCTCACCAGCTTTCGGATGG + Intergenic
1003441789 6:6149602-6149624 CTCCCTTCCCAGCTTGCAGATGG - Intronic
1005510530 6:26508316-26508338 CCCCCTTACCAGCAGCCAGAGGG - Intronic
1007214802 6:40228640-40228662 CCAGACTACCAGCTGCCAGAAGG + Intergenic
1008675483 6:53813487-53813509 CAACTTTACCAGCTGGAAGGTGG + Intronic
1010328438 6:74592686-74592708 CCATCTAATCAGCTGTCAGATGG + Intergenic
1018458294 6:163972226-163972248 GCTTCTTACCAGCTGGGAGAGGG + Intergenic
1020429480 7:8104651-8104673 CCTCCTCACTGGCTGGCAGAGGG + Intergenic
1022617957 7:31951829-31951851 CAACCTTTCCAGCAGGCAGAGGG - Intronic
1023802742 7:43849174-43849196 CCTCCTTCCCAGCTGTCAGTGGG - Intergenic
1024655788 7:51450477-51450499 CCACTTTCCCAGTTGGCATAGGG - Intergenic
1026048174 7:66922080-66922102 CCTCCTCACCAGCTGTCCGATGG - Intronic
1027360756 7:77406885-77406907 CCGCCTTAGCAGCGGGGAGAGGG - Intronic
1027786796 7:82590301-82590323 CCACGTTACCAGCTGCCCCATGG - Intergenic
1030071996 7:105705881-105705903 CCACCTTAGCACCTGGCACGTGG + Intronic
1031835697 7:126679536-126679558 CTACCTTACTATCTGGCATATGG - Intronic
1032758487 7:134915108-134915130 CCACCTTGGTATCTGGCAGATGG + Intronic
1035819707 8:2578493-2578515 CCACCTTGACACCTGGCAGCTGG - Intergenic
1038648486 8:29381137-29381159 GGACCTGACAAGCTGGCAGAAGG - Intergenic
1042058566 8:64792335-64792357 CCACCTATCCAGATTGCAGAAGG + Intronic
1047573975 8:126132860-126132882 TCTCCTTGCCAGCAGGCAGAAGG - Intergenic
1053481094 9:38417161-38417183 CAATCTCACCAGCTGCCAGATGG + Intronic
1057706022 9:97395801-97395823 CCACCTTACCAATTTGCAGGTGG + Intergenic
1057889418 9:98857465-98857487 CCACCTCTCCAGGTGGCAAAAGG - Intergenic
1058685462 9:107476264-107476286 CCACCATACCAGCTAAAAGAGGG - Intergenic
1060547747 9:124470830-124470852 CAGCCTTCCCAGCTGGCAGAGGG - Intronic
1062621833 9:137426312-137426334 TCACCTTGCCAGCTGGAAGTTGG - Exonic
1062635326 9:137487533-137487555 CCACCTGAGCAGCTGTAAGAGGG + Intronic
1186766752 X:12778560-12778582 CCACCTTTGAAGCTGTCAGAGGG - Intergenic
1187268550 X:17759554-17759576 CCAAATTACCATCCGGCAGAAGG - Intergenic
1190535339 X:51421096-51421118 CCAGCTCCCCAGCTGGCAGCAGG + Intergenic
1199745811 X:150771407-150771429 GCACCTTCCCAGCTGACAGGTGG + Intronic
1200076410 X:153553493-153553515 CCACCTTCTCACCTGGTAGAAGG - Intronic
1200304834 X:155013805-155013827 CCCTCTTCCCAGCTGGTAGATGG + Intronic
1200947171 Y:8855179-8855201 CTGACTTAACAGCTGGCAGATGG + Intergenic