ID: 944726684

View in Genome Browser
Species Human (GRCh38)
Location 2:202478486-202478508
Sequence TGGGACTACTTTGGAAGTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944726684_944726694 3 Left 944726684 2:202478486-202478508 CCCGTACTTCCAAAGTAGTCCCA 0: 1
1: 0
2: 0
3: 9
4: 130
Right 944726694 2:202478512-202478534 GTTTGGAAGGCTGAGGTGGGAGG 0: 31
1: 1645
2: 32096
3: 99628
4: 186763
944726684_944726690 -4 Left 944726684 2:202478486-202478508 CCCGTACTTCCAAAGTAGTCCCA 0: 1
1: 0
2: 0
3: 9
4: 130
Right 944726690 2:202478505-202478527 CCCAACTGTTTGGAAGGCTGAGG 0: 2
1: 59
2: 1722
3: 29832
4: 247059
944726684_944726695 19 Left 944726684 2:202478486-202478508 CCCGTACTTCCAAAGTAGTCCCA 0: 1
1: 0
2: 0
3: 9
4: 130
Right 944726695 2:202478528-202478550 TGGGAGGATCATTTGAGCCCAGG 0: 582
1: 9975
2: 30912
3: 65205
4: 113504
944726684_944726688 -10 Left 944726684 2:202478486-202478508 CCCGTACTTCCAAAGTAGTCCCA 0: 1
1: 0
2: 0
3: 9
4: 130
Right 944726688 2:202478499-202478521 AGTAGTCCCAACTGTTTGGAAGG 0: 1
1: 1
2: 34
3: 730
4: 12075
944726684_944726693 0 Left 944726684 2:202478486-202478508 CCCGTACTTCCAAAGTAGTCCCA 0: 1
1: 0
2: 0
3: 9
4: 130
Right 944726693 2:202478509-202478531 ACTGTTTGGAAGGCTGAGGTGGG 0: 2
1: 33
2: 751
3: 11150
4: 90824
944726684_944726692 -1 Left 944726684 2:202478486-202478508 CCCGTACTTCCAAAGTAGTCCCA 0: 1
1: 0
2: 0
3: 9
4: 130
Right 944726692 2:202478508-202478530 AACTGTTTGGAAGGCTGAGGTGG 0: 2
1: 33
2: 841
3: 13599
4: 107957
944726684_944726696 28 Left 944726684 2:202478486-202478508 CCCGTACTTCCAAAGTAGTCCCA 0: 1
1: 0
2: 0
3: 9
4: 130
Right 944726696 2:202478537-202478559 CATTTGAGCCCAGGAGTTTAAGG 0: 19
1: 482
2: 5280
3: 16438
4: 32352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944726684 Original CRISPR TGGGACTACTTTGGAAGTAC GGG (reversed) Intronic
900713610 1:4130201-4130223 AGGGAATAATTTGGAAGAACAGG - Intergenic
905870808 1:41403561-41403583 AGGGACTGTGTTGGAAGTACAGG - Intergenic
909671942 1:78199152-78199174 GGAGACTTCTTTGGAGGTACTGG - Intergenic
909976610 1:82053052-82053074 TGGAATTACCTTGGAAGTAGAGG + Intergenic
911208982 1:95119814-95119836 TGGGACTAATTTGGAAAGAAGGG - Intronic
911293036 1:96080980-96081002 TGGGACTATTTTGGGGGTATCGG + Intergenic
912177214 1:107174543-107174565 TGGGAGCACTTTGGAAGTCTTGG - Intronic
912323853 1:108739371-108739393 TGGGACTACAGGGGAACTACAGG - Intronic
915721464 1:157988788-157988810 TGGGAGGACTTTGGAAGAAGGGG + Intergenic
919429771 1:197477977-197477999 TGGGATTACACTGGAACTACAGG + Exonic
922721089 1:227900664-227900686 TGGGAATGCTGTGGAAGGACGGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
924865159 1:247971325-247971347 TTGCAGTACTTTGGAAGTAGTGG + Intronic
1063285730 10:4685743-4685765 CTGGACTACTTTGGAAGTGTTGG + Intergenic
1064258459 10:13765573-13765595 TGGAACCACCTTAGAAGTACGGG + Intronic
1071416202 10:85444324-85444346 TGGGACTTCATTGGGATTACAGG + Intergenic
1072508263 10:96091828-96091850 TGGGGTTACTTTGGAACTCCAGG + Intergenic
1077920572 11:6639139-6639161 TAGGACTACTTGGGAAGCAAAGG - Intronic
1078744825 11:14102355-14102377 TGCTACTACTTTGGATATACTGG - Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1092159329 12:6307414-6307436 TGGGAACACTTTGGAGGGACCGG - Intergenic
1092419539 12:8318942-8318964 GGAGACTTCTTTGGAGGTACTGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1096311937 12:50529155-50529177 TGGGACTATTTTGGGACTACAGG - Intronic
1097624679 12:61985644-61985666 TGGGAGAACTTCTGAAGTACAGG - Intronic
1098256478 12:68621319-68621341 TGTGACTAATTTGGATGTCCTGG - Intronic
1100999138 12:100338755-100338777 TTGGACTACTGTAGAAGTTCTGG - Exonic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1112389277 13:98968240-98968262 TGGTAATATTTTGGAAATACTGG + Intronic
1113134390 13:107073628-107073650 TTGGACTACTTTTTAAATACGGG + Intergenic
1113753224 13:112790854-112790876 TGGGATTAATTTGTAACTACAGG + Intronic
1116317556 14:43417415-43417437 AGGGCTTACTTTGGAAGAACAGG + Intergenic
1117112535 14:52473991-52474013 ATGGACTATTTTGGAAGTTCAGG - Intronic
1119497728 14:75095044-75095066 TGGGAATACCGTGGAAGTAGAGG + Intronic
1120440564 14:84532656-84532678 TGCGACTATTTTGGAAGAATGGG + Intergenic
1121651481 14:95562211-95562233 TGGGGCTAGTTAGGAAATACGGG - Intergenic
1124241306 15:28030306-28030328 AGGGGCTAGTTTGGAAGTAAGGG + Intronic
1127022167 15:54760334-54760356 TGGGACAACCAAGGAAGTACTGG + Intergenic
1127680780 15:61295794-61295816 TGGGATTTCACTGGAAGTACCGG - Intergenic
1139753536 16:69124174-69124196 TTGGAGTACTTTGTAAGAACTGG + Intronic
1152449725 17:80369846-80369868 TGAAACTGCTTTTGAAGTACAGG + Exonic
1154386278 18:13895336-13895358 TGGTACTACTTTGAAAGAAGAGG - Intronic
1158122751 18:54068146-54068168 TGGAACAACTTTGGAAGTTTGGG - Intergenic
1159089785 18:63834795-63834817 TGTGACTACTTAGGAAGTATTGG + Intergenic
1159093613 18:63876171-63876193 TGGGACTTCTTTATATGTACTGG - Intronic
1159865638 18:73701311-73701333 TGCCATTACTTTGGGAGTACTGG - Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166426421 19:42682885-42682907 TGGGACCACTTAGGAAAAACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925795842 2:7541643-7541665 TGGGACTACTTTGGCAGCTTAGG + Intergenic
936493833 2:112999905-112999927 TGGTAATACTTTGGAAGGATGGG - Intergenic
936555821 2:113498160-113498182 TGGGGCCACTTTGTAAGAACAGG + Intergenic
937282110 2:120725415-120725437 TGATAGTACTTTGGAAATACTGG - Intergenic
937306558 2:120875138-120875160 TGGGGCTACTTTGTATGTGCAGG + Intronic
941070408 2:160948420-160948442 TGGGACTTCTGTGCAAGCACTGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943278494 2:185899693-185899715 TGGGTCTAAGTTGGAAGTAGGGG - Intergenic
943799146 2:192035868-192035890 TGGAACCACTTTGGAAATAGGGG - Intronic
944611290 2:201410938-201410960 TTGGACTACTGTAGAAGTTCTGG + Intronic
944726684 2:202478486-202478508 TGGGACTACTTTGGAAGTACGGG - Intronic
947916356 2:233834334-233834356 TGGGAACAGTTTGGAAGTCCTGG - Intronic
948648220 2:239422372-239422394 TGGGAGGACGTGGGAAGTACAGG + Intergenic
948692327 2:239714406-239714428 TGGGTCTACTTTGGAAGCCCTGG - Intergenic
948817075 2:240517137-240517159 TGGGACAAAGTTGGAAGAACTGG + Intronic
1170681585 20:18530782-18530804 TGGTGCTACTTTGGACGTAAAGG + Exonic
1171004696 20:21453130-21453152 TGGAACTACAGTGGAACTACAGG + Intergenic
1173065402 20:39706037-39706059 TGGGAGAACTTTGGAAGTTATGG - Intergenic
1173176312 20:40767384-40767406 TGTGACTGCTTTGGGAGGACTGG + Intergenic
1175804900 20:61821697-61821719 GGGGTCTACTTTGGATCTACAGG + Intronic
1176200717 20:63859073-63859095 TGGGACTTGTTTGGAAATGCAGG - Intergenic
1177179159 21:17726303-17726325 TGTGTCTACTTTGGAAGTCCTGG - Intergenic
1182369300 22:29799624-29799646 GGGGACTTCTTTACAAGTACAGG - Intronic
950236051 3:11321083-11321105 TGGGAATGTTTTGGAAGTAATGG + Intronic
950759738 3:15210728-15210750 TGGGACTACTTTGTAGAGACAGG + Intronic
951210261 3:19966917-19966939 CTGGACTACTTGGGAGGTACAGG - Intronic
958482846 3:94666199-94666221 TGGGACTCTTTGGGAAGGACAGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
964088801 3:152849270-152849292 TGTTACTACTTTGGATGTAAAGG + Intergenic
967486965 3:190043992-190044014 TATGACTACCTTGGAAGTTCAGG - Intronic
975384397 4:73738681-73738703 TGGGACTGCTTTGCTAGTACAGG - Intergenic
976583430 4:86767200-86767222 TGGGACTACAGTGGGACTACAGG + Intronic
978052110 4:104214191-104214213 TGGGACTACTTTGAAAAGACTGG - Intergenic
982786439 4:159542681-159542703 TGGGAATAATTTGGAAGTGGAGG + Intergenic
982788562 4:159564064-159564086 TGGGACTACACTGGGACTACAGG + Intergenic
984273779 4:177582283-177582305 TGGGACTACTTTGAAAGAGATGG - Intergenic
984562564 4:181287919-181287941 TGGGACTACTTTGCAGTTAGAGG - Intergenic
986125827 5:4881696-4881718 TGTGACTACTTTGAAAATGCAGG + Intergenic
988283530 5:29181719-29181741 TGGGACCACTGTGGAAGTTGTGG - Intergenic
991942912 5:71871552-71871574 TGGGACTACATTGAACTTACAGG - Intergenic
994060345 5:95469621-95469643 TGTATCTACTTTGGAAGAACTGG - Intronic
994080969 5:95708783-95708805 GGTGACTTCCTTGGAAGTACCGG + Intergenic
995332830 5:110964830-110964852 TGGGACTCCATTTGAAGCACAGG - Intergenic
997986037 5:138502240-138502262 TGGGGCTAATTTGGAAGGCCGGG + Intergenic
999198317 5:149798203-149798225 TGGGGCTACTTTGGAGGCAATGG - Intronic
1002038305 5:176490468-176490490 TGGGCCTTCCCTGGAAGTACAGG + Intronic
1003269383 6:4593652-4593674 GGGGACCTTTTTGGAAGTACAGG + Intergenic
1003707873 6:8554895-8554917 TGTAAATACTTTGGAAGAACTGG + Intergenic
1008629859 6:53353201-53353223 GGGGACTACTGTGGAAGATCAGG - Intergenic
1008874442 6:56310245-56310267 TTGGACTACTTTGGAAGACCTGG + Intronic
1011079279 6:83471924-83471946 TGGGACAGCTTTGGGAGTCCTGG - Intergenic
1011574783 6:88784390-88784412 TGGGAATACTGTGGAGGCACAGG + Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1017901516 6:158722062-158722084 TGGCCCTGCTTTGGAAGTAGAGG + Intronic
1018268633 6:162052538-162052560 CAGGACTCCTTTGAAAGTACAGG + Intronic
1018559824 6:165090284-165090306 TGGGAGGACTATGGAAGTGCAGG - Intergenic
1022889053 7:34677150-34677172 CGGGACTACTTTGAAAAGACTGG + Intronic
1028550179 7:92052209-92052231 TGAGCCTACATTGGGAGTACAGG - Intronic
1028651612 7:93156372-93156394 TGGGACCATGTTGGAAATACGGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031041971 7:116847848-116847870 TTGGCCTAATTTGGAAGTACTGG + Intronic
1036440647 8:8778830-8778852 TGGCCCTACTTTGGAAAAACTGG + Intergenic
1038128972 8:24707846-24707868 TGCAACTAATTTGGACGTACTGG + Intergenic
1039439447 8:37584544-37584566 TGTGACAACTTGGGAAGTGCAGG - Intergenic
1040953668 8:52959014-52959036 TGGGGGTTCCTTGGAAGTACCGG + Intergenic
1041022709 8:53654413-53654435 TGTGACTAAATAGGAAGTACAGG + Intergenic
1045116011 8:98980855-98980877 TGGGTCTACTTTGAAAGGAGTGG - Intergenic
1047513745 8:125535651-125535673 TGGGACTACCTTGGAAAACCTGG + Intergenic
1049897201 9:119192-119214 TGGGGCCACTTTGTAAGAACAGG - Intergenic
1052614966 9:30826383-30826405 TGTGACTACTTTAAAAGTAAGGG - Intergenic
1053243805 9:36518215-36518237 TGGGACTACAGTGGGACTACAGG + Intergenic
1053740303 9:41129457-41129479 TGGGGCCACTTTGTAAGAACAGG - Intergenic
1054443268 9:65285450-65285472 TGGGGCCACTTTGTAAGAACAGG - Intergenic
1054487012 9:65736051-65736073 TGGGGCCACTTTGTAAGAACAGG + Intergenic
1054688046 9:68301856-68301878 TGGGGCCACTTTGTAAGAACAGG + Intergenic
1056577536 9:87867963-87867985 TGTGATGACTTTGGAAGCACTGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1062192388 9:135254703-135254725 TGGGTCTGCTGTTGAAGTACGGG - Intergenic
1186386675 X:9117023-9117045 TGGGACTATCTTGGAAGTTGAGG - Intronic
1190228852 X:48565911-48565933 TGGGACTACAGTGGAACTAGAGG - Intergenic
1190527432 X:51342140-51342162 TGGGCCTATTTTGCAAGTAATGG + Intergenic
1190558443 X:51662554-51662576 TGGGAATCCTTTGAAAGCACTGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192822530 X:74659518-74659540 TGGGATTACTAAGGAAGTACTGG - Intergenic
1193925293 X:87476684-87476706 TGGGACAACTAAGGGAGTACTGG - Intergenic
1195601542 X:106754353-106754375 TGGGACTACAGTGGGACTACAGG + Intronic
1195656915 X:107340530-107340552 GGGAACAGCTTTGGAAGTACAGG + Intergenic
1198819081 X:140626508-140626530 TGGTACTACCTTCAAAGTACAGG - Intergenic