ID: 944727667

View in Genome Browser
Species Human (GRCh38)
Location 2:202487641-202487663
Sequence GTATTTTTCTGAACTGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944727664_944727667 -1 Left 944727664 2:202487619-202487641 CCACAATCAAGTTATACTTTTTG 0: 1
1: 0
2: 0
3: 17
4: 226
Right 944727667 2:202487641-202487663 GTATTTTTCTGAACTGGTCTGGG 0: 1
1: 0
2: 2
3: 19
4: 168
944727663_944727667 10 Left 944727663 2:202487608-202487630 CCTGTATTGCACCACAATCAAGT 0: 1
1: 0
2: 0
3: 4
4: 61
Right 944727667 2:202487641-202487663 GTATTTTTCTGAACTGGTCTGGG 0: 1
1: 0
2: 2
3: 19
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944727667 Original CRISPR GTATTTTTCTGAACTGGTCT GGG Intronic