ID: 944727667

View in Genome Browser
Species Human (GRCh38)
Location 2:202487641-202487663
Sequence GTATTTTTCTGAACTGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944727663_944727667 10 Left 944727663 2:202487608-202487630 CCTGTATTGCACCACAATCAAGT 0: 1
1: 0
2: 0
3: 4
4: 61
Right 944727667 2:202487641-202487663 GTATTTTTCTGAACTGGTCTGGG 0: 1
1: 0
2: 2
3: 19
4: 168
944727664_944727667 -1 Left 944727664 2:202487619-202487641 CCACAATCAAGTTATACTTTTTG 0: 1
1: 0
2: 0
3: 17
4: 226
Right 944727667 2:202487641-202487663 GTATTTTTCTGAACTGGTCTGGG 0: 1
1: 0
2: 2
3: 19
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944727667 Original CRISPR GTATTTTTCTGAACTGGTCT GGG Intronic
901166029 1:7222251-7222273 GTCTTTTTCTGTGCTCGTCTGGG + Intronic
902109756 1:14068374-14068396 GTATTTTTCTAACTGGGTCTTGG - Intergenic
905513867 1:38546333-38546355 CCAGTTCTCTGAACTGGTCTTGG - Intergenic
908653300 1:66360116-66360138 GTATTTTTCTGAAGTTTCCTGGG + Intronic
909180268 1:72415351-72415373 GTATTTTTAAGGACTGTTCTGGG + Intergenic
910541817 1:88367837-88367859 GTAATATTCTGAAGGGGTCTTGG + Intergenic
911223784 1:95280687-95280709 TTATTTTTCTTAAATGCTCTAGG - Intergenic
912864357 1:113244152-113244174 GGATTTTTCTCAACTGGTCTAGG - Intergenic
912881569 1:113421802-113421824 GTGTATTTCTGGACTGCTCTTGG + Intronic
912992452 1:114502167-114502189 GGCTTTTTCTGAACTGTTATGGG + Intronic
914503824 1:148271176-148271198 GCATGTTTCAGTACTGGTCTGGG - Intergenic
917029857 1:170678151-170678173 GTATCTTACTCAACTGGTTTAGG - Intronic
918872320 1:189991448-189991470 GGATTTTTCTGCACTGTCCTTGG - Intergenic
918956145 1:191210330-191210352 GTTTTTTTCTGAACCTGACTAGG + Intergenic
919535974 1:198788452-198788474 TGATTTTTCTGAGATGGTCTGGG + Intergenic
919555188 1:199043971-199043993 TTATTTTTTTTATCTGGTCTGGG - Intergenic
1065318882 10:24490660-24490682 GTATTTTTGTGAAGTGGCTTTGG + Intronic
1065334822 10:24645909-24645931 CTGTTTTTCTGAAGTGGTCAGGG + Intronic
1069321273 10:67174531-67174553 TTATTTTTCTGAGCTGCTCTGGG - Intronic
1069619199 10:69826081-69826103 GTATTTTTCTCAAGTGGCCTAGG - Intronic
1070468192 10:76746980-76747002 TTATTCTTCTGAACAAGTCTAGG - Intergenic
1072046594 10:91662933-91662955 CTATTTTTCAGAACTGGTTTAGG - Intergenic
1073223820 10:101899232-101899254 GTATATCACTGGACTGGTCTAGG - Intronic
1073439959 10:103546694-103546716 GTAATTTTCTGAATTGATTTGGG + Intronic
1075989952 10:126827016-126827038 TTATTTGTCTGAATGGGTCTTGG - Intergenic
1077866955 11:6230291-6230313 GAATTTTACTGACCTGTTCTTGG - Intronic
1077955205 11:7011196-7011218 GTATCATTCTTATCTGGTCTTGG - Intronic
1081297076 11:41404404-41404426 GGTATTTTCAGAACTGGTCTGGG + Intronic
1083451759 11:62750953-62750975 GTATTTCTTTGAACTGGTGTTGG - Exonic
1088168445 11:106966528-106966550 GTATTTTTGGGTACTGTTCTAGG - Intronic
1088426377 11:109709329-109709351 CTATTTTTCTTAACTGTACTCGG - Intergenic
1088769027 11:113014726-113014748 GGATTTTTCTGAGGTCGTCTTGG + Intronic
1090457753 11:126864549-126864571 CTATGTGTCTGAACTGGTCTTGG + Intronic
1092805971 12:12222936-12222958 TGGTTTTTCTGAATTGGTCTAGG - Intronic
1093080821 12:14808645-14808667 AAATTTTTCTGAAATGGTTTAGG + Intronic
1093788797 12:23222733-23222755 AGACTTTTGTGAACTGGTCTAGG + Intergenic
1098351096 12:69561664-69561686 TGATTTTTCTGAACTGGTTTTGG + Intronic
1098834005 12:75398559-75398581 TTCTTTTTCTGAGCTGTTCTGGG + Intronic
1101783125 12:107855098-107855120 GTCTTTTTGAAAACTGGTCTTGG + Intergenic
1104863439 12:131938065-131938087 TTATTTTTGTTAACTGGTCTGGG + Intronic
1105934742 13:25088608-25088630 GTTTTTCTATGAACTGGTCCTGG + Intergenic
1107071962 13:36279599-36279621 GTATTTTTATGAAGTGCCCTAGG + Intronic
1107206639 13:37798381-37798403 TTTTTTTTCTGAAGTGGTGTAGG - Intronic
1107292946 13:38877805-38877827 TTATTTTTGTAAACTGGACTTGG + Intronic
1108089820 13:46837274-46837296 GTATCTTTCTCTACTGGCCTGGG + Intronic
1108269753 13:48748230-48748252 ATATTTTTGTTAACTGGACTTGG - Intergenic
1108544271 13:51475821-51475843 GTGGTTTTCTGAACTGGGTTTGG - Intergenic
1108844537 13:54661254-54661276 GTATTATTGTGAACTTCTCTGGG + Intergenic
1110190606 13:72726090-72726112 GGCTTTTTCTGCACTGGTCCTGG - Intronic
1110266985 13:73549683-73549705 TAAGTTTTCTGAACAGGTCTTGG + Intergenic
1113105920 13:106771538-106771560 GTCTTTGTCTGAACTGTTCGGGG + Intergenic
1113797075 13:113064755-113064777 GTATGTTTCTGAAGAGGTCAAGG + Intronic
1114480225 14:23029084-23029106 GTATTTTTTATAACTGGTGTGGG + Intronic
1115050621 14:29057508-29057530 TTATTTCTCTGAAGTGATCTTGG + Intergenic
1115067885 14:29287011-29287033 GTGGTTTTCTGAACTGGTTTTGG - Intergenic
1116115882 14:40650181-40650203 TGATTTTTCTGAACTGGTTTTGG + Intergenic
1116597825 14:46874859-46874881 GTCTTTCTCTGAACTTGTGTTGG - Intronic
1116839004 14:49800239-49800261 GTATTTTTCTACCCTGGTCCTGG + Intronic
1118792721 14:69110231-69110253 TTTTTTTTCTGATCTGTTCTTGG + Intronic
1121186177 14:91971818-91971840 CTATTTTTCTGAACTTGTATAGG - Intronic
1121292055 14:92783879-92783901 GTATTTTTATGAATTGACCTTGG - Intergenic
1121457742 14:94049471-94049493 GTAGTTTTCTGAACTTGTCCTGG + Exonic
1124131013 15:26985655-26985677 GCATTTTTCTGAGCTGGTCTTGG + Intronic
1125455614 15:39855988-39856010 ATATTTTTCTGAATTTGTTTCGG - Intronic
1126839278 15:52700529-52700551 GGCTTTTTTTGAAGTGGTCTTGG - Intronic
1129270613 15:74417537-74417559 GGATGCTTCTGAACTGGGCTGGG - Intronic
1132178021 15:99731311-99731333 TTATTTTTCTGAACCTTTCTTGG - Intronic
1135206226 16:20486499-20486521 GCATTTTTCAGAACTGCTGTAGG - Intronic
1135212693 16:20537415-20537437 GCATTTTTCAGAACTGCTGTAGG + Intronic
1135693755 16:24567985-24568007 GAATTTTTCTGATTCGGTCTAGG + Intronic
1137305301 16:47193002-47193024 GTATTTGTCTGTTCTGGTTTTGG + Intronic
1140084843 16:71786086-71786108 ATATTTTTCTGAATGGGACTGGG - Intronic
1143069765 17:4281141-4281163 GTTATTTTCTGAATTGGTGTAGG - Intronic
1143861744 17:9896504-9896526 GCATTTTTCTGACCTCATCTTGG + Exonic
1144243164 17:13334427-13334449 TTATCTTTCTGGACTGGTCATGG - Intergenic
1146010708 17:29192229-29192251 GTAGTTTGCTGACCTGGCCTAGG + Intergenic
1146611920 17:34313677-34313699 CTCTATTTCTGAAGTGGTCTAGG - Intergenic
1146959614 17:36962625-36962647 TTATTTTTCTGAGCTACTCTGGG - Intronic
1151891628 17:76954288-76954310 GCATTTTTTTGAACTAGCCTTGG + Intergenic
1153562811 18:6388492-6388514 GTAGTTTTCTGAACTCAGCTGGG - Intronic
1156933997 18:42680441-42680463 CTACTTTTCTGAACTTGTCAAGG + Intergenic
1156953047 18:42928217-42928239 ATATATATCTGAACTTGTCTGGG + Intronic
1160614564 18:80114971-80114993 GCATTTTTATGATCTAGTCTTGG + Intronic
1164758876 19:30712509-30712531 GTATTTTTGTAAACTGCTGTAGG - Intronic
1165064787 19:33222687-33222709 GTGTTTTTCTGAACAGATATTGG + Intronic
1166477542 19:43141604-43141626 GGATTTTTCTCAGCTGGACTTGG + Intronic
929043004 2:37764009-37764031 TTATTTTTATGTACTGGTATTGG - Intergenic
929433918 2:41912551-41912573 CTATTTTTCAGAACTGGTTCTGG - Intergenic
930489163 2:52045693-52045715 GTATTTTGCTGAATTGCTCTGGG + Intergenic
930644881 2:53895284-53895306 GTATTTCTCTGGGCTGGTTTAGG + Intronic
930921223 2:56756411-56756433 GTTCTTTTCAGAAATGGTCTGGG + Intergenic
933866505 2:86523058-86523080 GTCTTATTTTGAACTTGTCTTGG + Intronic
939626785 2:144486874-144486896 CAATTCTTCTGAACTGGTATTGG + Intronic
940636260 2:156300679-156300701 GTATTTATCAGAGCTGGTTTTGG - Intergenic
942942483 2:181635161-181635183 TTATTTTTATGAAATGTTCTTGG - Intronic
943771633 2:191723595-191723617 ATATTTTTCAGAACTAGACTGGG - Intergenic
944192061 2:197013818-197013840 GTGTTTTTCTGACGTGCTCTTGG - Intronic
944727667 2:202487641-202487663 GTATTTTTCTGAACTGGTCTGGG + Intronic
945002881 2:205370463-205370485 ATATTATCCTGAACTGGTCCAGG - Intronic
1169148599 20:3271219-3271241 GTGTTGTTCTGAACTGGTGAAGG - Intronic
1169350752 20:4866264-4866286 GTTTGTTTCTGTACTGTTCTGGG - Intronic
1169780193 20:9301395-9301417 GTATTGACCTAAACTGGTCTAGG + Intronic
1170422566 20:16207275-16207297 TTATTTTCCTGCACTGGTCCTGG - Intergenic
1172200045 20:33119177-33119199 GTACTTTTGTGATCTGGTTTTGG + Intergenic
1176915201 21:14617323-14617345 GTCTTTTTCTGAAATTGTTTAGG + Intronic
1178665033 21:34538833-34538855 CTATTTTTCTGAAGTGACCTGGG + Intronic
1178800843 21:35794112-35794134 GTCTTTTTCTGAAGTTGTTTTGG + Intronic
1181409036 22:22705172-22705194 GTATTTTTCGGGACTGATGTAGG - Intergenic
1182071789 22:27468984-27469006 GTAACTTTCTCAACAGGTCTTGG + Intergenic
1182658950 22:31911522-31911544 GTGTTTTTCTGAACTTTTCTGGG - Intergenic
950539551 3:13602378-13602400 TTATTTTTCAGAAATGTTCTCGG + Intronic
950710194 3:14808563-14808585 GTGTTTTTCCCAACTGGCCTTGG + Intergenic
950721465 3:14885726-14885748 GCATTTTTATGATCTGGCCTTGG + Intronic
950935288 3:16833317-16833339 CTATTTTTTAGAACTGGACTAGG - Intronic
951148883 3:19263647-19263669 GAATTTTTGTGAACTCATCTAGG + Intronic
951714247 3:25622259-25622281 GTGTTTTACTGAAATGGTTTTGG - Intronic
951983730 3:28594663-28594685 GTTTTTTTATGAACTAGCCTCGG + Intergenic
963863950 3:150340371-150340393 GTCTTTCTCAGAACTGCTCTGGG - Intergenic
964586101 3:158303860-158303882 GTATTTTTCAGGACTGGAGTTGG + Intronic
965481819 3:169227964-169227986 GTATTTGTCTCAATTGTTCTTGG - Intronic
965868963 3:173243098-173243120 GTGTTTTTCTAAACTTTTCTAGG + Intergenic
971011377 4:22439853-22439875 GTATTTTTTTGAGCTGGGGTGGG - Intronic
973135596 4:46702043-46702065 GTATTTTTCTTAACTGTTAATGG - Intergenic
975125285 4:70775598-70775620 GCATATTTCAGAACTGATCTTGG + Intronic
975255053 4:72224284-72224306 GTGTGTTTCTGAGCTGGACTAGG - Intergenic
976234774 4:82884742-82884764 GAATTTTTGTGAATTGTTCTTGG + Intronic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
977617551 4:99103216-99103238 TTAATTTTCTGACCTGGTTTAGG + Intergenic
977753874 4:100642193-100642215 GTGTTTTTCTGAATTGGTCCTGG - Intronic
977939089 4:102839004-102839026 GTATTTTACTGAATCTGTCTGGG - Intronic
978119717 4:105064066-105064088 GTATTTTTATGAAATTGTATGGG - Intergenic
981642274 4:146958368-146958390 TTATTTTTTTGAGCTGGTCGAGG - Intergenic
982272457 4:153605186-153605208 GTATTTTCCTTAACTGTTTTTGG - Intronic
982850259 4:160306170-160306192 GAATTTTTAGCAACTGGTCTAGG - Intergenic
983758014 4:171365905-171365927 GTATTTTTCTGAACTGCCTGTGG - Intergenic
984866088 4:184281968-184281990 GGATTTTTCTAAACTGATCCGGG - Intergenic
989321681 5:40142273-40142295 ATTTTTTTCTGAACTATTCTGGG + Intergenic
990387710 5:55283553-55283575 GGATTTTTCTGCACTGTCCTTGG - Exonic
991386217 5:66093134-66093156 TTACTTATCTAAACTGGTCTGGG + Intergenic
991416130 5:66395086-66395108 GTAAGTTTCTTAACTGCTCTGGG + Intergenic
992035516 5:72770950-72770972 TTATTTTTGTGATCAGGTCTGGG - Intergenic
992908507 5:81372119-81372141 GTATTTTCCTTAACTTCTCTTGG - Intronic
992974884 5:82105122-82105144 GTAATTTGCTGTACTGGTATTGG + Intronic
995437110 5:112149037-112149059 CTATTTTTCTAAATTGTTCTGGG + Intronic
997956980 5:138286419-138286441 GTCTCTGTCTGAACTGGTGTGGG + Intronic
998074074 5:139222071-139222093 GTATGTTTCTAAACTGCTCTTGG - Intronic
1002110015 5:176902393-176902415 GTATTTTCCTGATCAGGACTGGG - Intergenic
1003122465 6:3329423-3329445 GGATTTTTCTGGACTGGAGTTGG + Intronic
1008224900 6:48902703-48902725 ATATTTTTCTCTACTTGTCTTGG - Intergenic
1010371242 6:75110533-75110555 CTATTTTTTTCTACTGGTCTGGG - Intronic
1010811526 6:80305833-80305855 CTATCTTACTGAACTGCTCTTGG + Intronic
1011150806 6:84271146-84271168 GTTTCTTTCTTAACTGGTGTAGG + Intergenic
1013651555 6:112200195-112200217 CTCTTTTTCTAAACTGCTCTGGG - Intronic
1016931378 6:149413906-149413928 CTATTTATCTGAATTGGTCTAGG + Intergenic
1017141529 6:151194988-151195010 TTATTTTTGTGAACTGTTCATGG - Intergenic
1018889624 6:167974251-167974273 GTATTTTGCTCAACTGAACTAGG - Intergenic
1021137976 7:16989573-16989595 TTATTTTTCTGAACTGTTGATGG - Intergenic
1024728836 7:52231996-52232018 GTTTTTTTATGACCTGGGCTTGG - Intergenic
1026004096 7:66587241-66587263 GTATTTCTCTAAACTAGTGTGGG - Intergenic
1028750367 7:94376012-94376034 GTTTTTTTTTAAACTGGGCTGGG - Intergenic
1029924929 7:104305241-104305263 GTATGTTGCAGAACTGGGCTTGG - Intergenic
1033983331 7:147192920-147192942 ATAATTTTCTGGACTAGTCTGGG - Intronic
1034198648 7:149266848-149266870 GTATTTCTCTGAGCTGGAGTGGG + Exonic
1037048578 8:14340984-14341006 CTATTTCTCTGAACTGCTCGAGG + Intronic
1038650371 8:29397504-29397526 GTATTTCTCTGAGTTGGTTTAGG + Intergenic
1041559863 8:59204489-59204511 GAATTTTTCTGAACTGATGAAGG - Intergenic
1041999093 8:64100958-64100980 TTATTTTTCTGCAATGGTTTGGG - Intergenic
1042690176 8:71489575-71489597 GTATGTTTTTGAACAGTTCTAGG + Intronic
1042973669 8:74439554-74439576 GTATTTCTTTAAACTTGTCTTGG + Intronic
1043018371 8:74969517-74969539 TTATTTTTCTGTACTAGCCTGGG + Intergenic
1044580918 8:93825455-93825477 TTCTTTTTCTGAACATGTCTGGG + Intergenic
1048562645 8:135558203-135558225 GTAAATTCCTGAGCTGGTCTAGG + Intronic
1050021440 9:1288437-1288459 GTATTTTTCTAAAGTGATCAAGG - Intergenic
1051711100 9:19932204-19932226 TTTTTGTTCTGAAATGGTCTTGG + Intergenic
1052253107 9:26423406-26423428 GCATTTTTGTGACCTGGTTTAGG + Intergenic
1052541656 9:29817892-29817914 GTATTTGTATGAATGGGTCTTGG - Intergenic
1055030258 9:71767092-71767114 GTTCTTTTCAGAATTGGTCTGGG - Intronic
1055107683 9:72529237-72529259 CTATTTTTGTGAACTGGTAAAGG + Intronic
1055224064 9:73972107-73972129 TTATTTTTCAGAACTGTTTTAGG - Intergenic
1057693001 9:97303245-97303267 TTAGTTTTCTGAACTGGTTTTGG - Intergenic
1057956075 9:99409080-99409102 GACTTTTACTTAACTGGTCTAGG - Intergenic
1058325505 9:103692207-103692229 GTATTTTTCTGCACTGATAAGGG + Intergenic
1186057346 X:5664099-5664121 GTCATTTTCTAAACTGGGCTGGG - Intergenic
1186187610 X:7037199-7037221 GGATTTTTCTCAGCTGGACTTGG + Intergenic
1188024735 X:25196211-25196233 GAATTTTTCTGACCTTGTCCTGG + Intergenic
1192295705 X:69845703-69845725 GTATTTTTATGACCTAGCCTTGG - Intronic
1192625203 X:72719903-72719925 GTATTTTTCTAAATGGGTCTAGG + Intergenic
1194375395 X:93126244-93126266 GTCTTTTTATGAACTCATCTTGG + Intergenic
1195636399 X:107120623-107120645 GTAAGTTTCTTAACTGGTCTAGG + Intergenic
1197727248 X:129784605-129784627 GTATGTTTCTTAACTTCTCTAGG - Intronic