ID: 944732321

View in Genome Browser
Species Human (GRCh38)
Location 2:202529336-202529358
Sequence ATTTGGGTATGGAGGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 996
Summary {0: 1, 1: 1, 2: 3, 3: 77, 4: 914}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944732321_944732332 16 Left 944732321 2:202529336-202529358 CCACCCTCCCTCCATACCCAAAT 0: 1
1: 1
2: 3
3: 77
4: 914
Right 944732332 2:202529375-202529397 AGTACAGAGGGGAGTTTAAAAGG 0: 1
1: 0
2: 2
3: 21
4: 184
944732321_944732330 4 Left 944732321 2:202529336-202529358 CCACCCTCCCTCCATACCCAAAT 0: 1
1: 1
2: 3
3: 77
4: 914
Right 944732330 2:202529363-202529385 AAAATTAAAATGAGTACAGAGGG 0: 1
1: 0
2: 7
3: 70
4: 888
944732321_944732331 5 Left 944732321 2:202529336-202529358 CCACCCTCCCTCCATACCCAAAT 0: 1
1: 1
2: 3
3: 77
4: 914
Right 944732331 2:202529364-202529386 AAATTAAAATGAGTACAGAGGGG 0: 1
1: 0
2: 6
3: 45
4: 576
944732321_944732329 3 Left 944732321 2:202529336-202529358 CCACCCTCCCTCCATACCCAAAT 0: 1
1: 1
2: 3
3: 77
4: 914
Right 944732329 2:202529362-202529384 GAAAATTAAAATGAGTACAGAGG 0: 1
1: 0
2: 5
3: 59
4: 542
944732321_944732333 17 Left 944732321 2:202529336-202529358 CCACCCTCCCTCCATACCCAAAT 0: 1
1: 1
2: 3
3: 77
4: 914
Right 944732333 2:202529376-202529398 GTACAGAGGGGAGTTTAAAAGGG 0: 1
1: 0
2: 1
3: 10
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944732321 Original CRISPR ATTTGGGTATGGAGGGAGGG TGG (reversed) Intronic
900078184 1:834944-834966 ATGGGTGGATGGAGGGAGGGAGG - Intergenic
901002173 1:6154349-6154371 ACGTGGGCCTGGAGGGAGGGCGG - Intronic
901051802 1:6429090-6429112 TCTTGGGGAGGGAGGGAGGGAGG + Intronic
901306442 1:8236371-8236393 AGTTGGGGAGGGAGGGAGGGAGG - Intergenic
901351774 1:8603631-8603653 ATTTGTGTATTGGGGAAGGGAGG + Intronic
901502763 1:9663728-9663750 GTTTTGGGATGGGGGGAGGGGGG - Intronic
901634610 1:10664811-10664833 AGGTGGGGAGGGAGGGAGGGAGG - Intronic
901843310 1:11966743-11966765 ACATGGGCATGGAGGGAGGGAGG - Intronic
902917753 1:19648763-19648785 ATTTGGGAGTGGCGGGTGGGTGG + Intronic
903204327 1:21769378-21769400 ACTTGGGGGTGGAGGGTGGGAGG + Intronic
903331673 1:22599934-22599956 AGTGGGGGAGGGAGGGAGGGAGG + Intronic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903554844 1:24186114-24186136 ACCTGTGTGTGGAGGGAGGGTGG - Intronic
903838022 1:26218548-26218570 TTTTGGGGTTGGGGGGAGGGGGG + Intergenic
903898974 1:26629062-26629084 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
903957126 1:27033255-27033277 GTTTGGGTACCGTGGGAGGGAGG + Intergenic
904372506 1:30058812-30058834 ATTGAGGGAGGGAGGGAGGGAGG - Intergenic
905105043 1:35559019-35559041 AGTGGAGGATGGAGGGAGGGAGG - Intronic
905313570 1:37066866-37066888 AGATGGGGAAGGAGGGAGGGAGG - Intergenic
905852800 1:41286641-41286663 ATTGGGGGATGGGGGGTGGGAGG - Intergenic
905909460 1:41643847-41643869 ATTTGGGGAGGGGGTGAGGGGGG - Intronic
905912476 1:41663591-41663613 ATCTGGCTTTGGAGGAAGGGTGG - Intronic
906256215 1:44352779-44352801 ATTTGGGCTTGGAGGGTAGGGGG - Intronic
906318285 1:44801780-44801802 GGTTGGGGAGGGAGGGAGGGAGG + Intronic
906381766 1:45337006-45337028 GTTTGGCTATGAAGGGAAGGAGG - Intronic
906652043 1:47519755-47519777 GTGTGGGCAGGGAGGGAGGGTGG + Intergenic
906702352 1:47869047-47869069 TTTGGGGGAAGGAGGGAGGGAGG - Intronic
906708867 1:47914644-47914666 ATTTGGCAATGGAGGGAAAGAGG - Intronic
906743658 1:48206617-48206639 GTTTGTGTGTGGGGGGAGGGGGG + Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907499134 1:54865790-54865812 AGGTGGGAAGGGAGGGAGGGAGG - Intronic
907506539 1:54923167-54923189 GTTGGGGTGGGGAGGGAGGGAGG - Intergenic
907770217 1:57454500-57454522 ACTTGAGGATGGAGGGTGGGAGG + Intronic
908133898 1:61107824-61107846 ATTTGTGTATGGTGTGAGGTAGG + Intronic
908155551 1:61349081-61349103 AATAGGCTATGGAGGAAGGGTGG - Intronic
908318253 1:62955587-62955609 ATTTGGGGATGAAGGGGGTGGGG + Intergenic
908338388 1:63150581-63150603 ATTTCAGTATGGAGGGATGGAGG + Intergenic
908682817 1:66681804-66681826 ATTTGTGTGGGGAGTGAGGGAGG - Intronic
909568616 1:77083371-77083393 ACTTGGGGGTGGAGGGTGGGAGG - Intergenic
909577766 1:77194632-77194654 ATTTGTGGGTGGAGGGTGGGGGG + Intronic
909750720 1:79157268-79157290 ATTGGAGAATGGAGGGTGGGAGG - Intergenic
910194328 1:84624656-84624678 ATTTGGGTGTGGGGGGGTGGGGG - Intergenic
910205172 1:84742535-84742557 CTTTGAGGATGGAGGAAGGGTGG + Intergenic
910370492 1:86510437-86510459 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
910535170 1:88289187-88289209 ATTTAGCTATTGAAGGAGGGTGG - Intergenic
910575490 1:88758525-88758547 ATTGGAGTGTGGAGGGTGGGAGG - Intronic
910884795 1:91953096-91953118 ATGTTGGGGTGGAGGGAGGGGGG - Intronic
911532002 1:99054065-99054087 ATTTGTGTATGGACAGATGGGGG - Intergenic
911656465 1:100449468-100449490 ATTTGGGTATGGGGAGGGAGTGG - Intronic
911877194 1:103181870-103181892 CTTGGGCTATGGAGGGAGTGCGG - Intergenic
912149765 1:106843796-106843818 TTTTGGGTCAGGAGGGAGGCTGG + Intergenic
912179112 1:107196195-107196217 ATTTGGCTTTGGTGGGAGTGGGG + Intronic
912510726 1:110188588-110188610 ATTTGAGAGAGGAGGGAGGGAGG - Intronic
912663873 1:111561505-111561527 ATTGGGGGAAGGAGGGAGGAAGG + Intronic
912937260 1:114014411-114014433 AGTTGGGAATGGAGGTGGGGTGG + Intergenic
912993061 1:114508731-114508753 CTATGGGAATGGAGGGATGGGGG - Intronic
913713340 1:121509671-121509693 ATTGGAGTGTGGAGGGTGGGAGG + Intergenic
914375864 1:147073059-147073081 ATTAGGATTGGGAGGGAGGGAGG + Intergenic
915007759 1:152655876-152655898 ATTGGGGAAGGGAAGGAGGGAGG - Intergenic
915268241 1:154733818-154733840 TGTTGGGGATGAAGGGAGGGAGG - Intronic
915367476 1:155324032-155324054 AGGTGGGTCTGGAGGGAGAGGGG - Intronic
915378754 1:155422017-155422039 ATTAGGGGTTGGAGGGAGGATGG - Intronic
915592403 1:156878220-156878242 ATCTTTCTATGGAGGGAGGGAGG - Intronic
915857805 1:159408461-159408483 GTTGGGGGATGGGGGGAGGGGGG + Intergenic
916616498 1:166446597-166446619 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
916667694 1:166981483-166981505 ATGTGTGTAGAGAGGGAGGGAGG + Intronic
916699607 1:167277828-167277850 ATTTGGGAAGTGAGGGAGAGGGG - Intronic
917379156 1:174384295-174384317 ATTTGGGTATGGGGGGAATGAGG + Intronic
917549746 1:176012979-176013001 ATTTTGGTATGGAGGGCATGGGG - Intronic
917933233 1:179838838-179838860 AGTTGGGTATGGATGGGGGTGGG + Intergenic
918105585 1:181413082-181413104 AGTGGGGAAGGGAGGGAGGGAGG - Intronic
918135693 1:181672230-181672252 ACTTGAGTGTGGAGGGTGGGAGG + Intronic
918745549 1:188194207-188194229 GTTGTGGGATGGAGGGAGGGGGG + Intergenic
919347987 1:196411010-196411032 AGGTGGGAAGGGAGGGAGGGAGG - Intronic
919695519 1:200570905-200570927 ATTTGAGGATGGTGGGTGGGAGG - Intronic
920110486 1:203583809-203583831 AGGTGGGAACGGAGGGAGGGAGG + Intergenic
920602991 1:207347727-207347749 ATTTGAGAATGGAAGGTGGGAGG - Intronic
921370703 1:214419934-214419956 ATAGAGGGATGGAGGGAGGGAGG - Intronic
921734715 1:218613854-218613876 ATTTGGGTAAGGATGGGTGGGGG - Intergenic
921804414 1:219437510-219437532 ATATGGAAATGTAGGGAGGGAGG - Intergenic
922108492 1:222533426-222533448 ATGTGTGTATGGGGGCAGGGTGG + Intronic
922916260 1:229260055-229260077 AGTTGGGTGGGGAGGGGGGGTGG + Intergenic
923064145 1:230502815-230502837 ACTAGAGAATGGAGGGAGGGGGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923608198 1:235464493-235464515 ATGTGGGAAGTGAGGGAGGGAGG - Intronic
923903205 1:238352626-238352648 ACTTGGGCATGGAGGCTGGGAGG - Intergenic
923978254 1:239289474-239289496 ATTAGGGAAGGGAGGGAGAGTGG - Intergenic
924329981 1:242931841-242931863 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
924373035 1:243375125-243375147 AGGTGGGTATGTAGGGTGGGTGG + Intronic
924587469 1:245372514-245372536 ACTTGGGGGTGGAGGGTGGGAGG - Intronic
924946297 1:248849149-248849171 ATGTGGGTATGGAGGTGGGTGGG + Exonic
1063015582 10:2073749-2073771 ATGTGGGTATGGAGTCAAGGTGG - Intergenic
1063149688 10:3324939-3324961 ATATGGCTAGGGAAGGAGGGTGG + Intergenic
1063157240 10:3391013-3391035 ATGTGGGGATGGAGGAATGGGGG + Intergenic
1064149382 10:12849947-12849969 ATGGGGGGAAGGAGGGAGGGAGG - Intergenic
1064442159 10:15363828-15363850 GTTGGGGAATAGAGGGAGGGAGG - Intronic
1064483453 10:15762255-15762277 ATGGAGGGATGGAGGGAGGGAGG - Intergenic
1064818395 10:19293750-19293772 ATTTGAGGGTGGAGGGTGGGAGG + Intronic
1065096058 10:22281977-22281999 ACTTGAGGATGGACGGAGGGAGG + Intergenic
1065674110 10:28155898-28155920 ATTTGGGGATAGAGGCAGTGTGG - Intronic
1066016355 10:31248116-31248138 ATCTGAGAATGGAGGGAGGAAGG - Intergenic
1066086958 10:31980477-31980499 ACTTGGGGAGGGAGGGTGGGAGG - Intergenic
1066218095 10:33308206-33308228 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1066506477 10:36049800-36049822 ATTTGGGTGGGGAGGGATGAAGG + Intergenic
1067146646 10:43699057-43699079 AACTGGGTGTGGAGGGAGAGGGG + Intergenic
1068057339 10:52027302-52027324 ATATGTGTATGGGTGGAGGGTGG + Intronic
1068745147 10:60521942-60521964 ATTTAAGCATGGAGGGATGGAGG + Intronic
1068906178 10:62325536-62325558 ATGGGAGTATGGAGGGTGGGAGG + Intergenic
1069232700 10:66031556-66031578 AGTTGGGGAGGGAGGGAGAGAGG + Intronic
1069582812 10:69576898-69576920 AATTGTGCAGGGAGGGAGGGGGG + Intergenic
1069640538 10:69952672-69952694 ATTTGGCTAAGGTGGGTGGGAGG - Intronic
1069752005 10:70750819-70750841 ATTTGTGTATGGTGTGAGGAAGG - Intronic
1069817374 10:71207011-71207033 ACTTAGGGATGGAGGAAGGGAGG - Intergenic
1069818664 10:71214251-71214273 CTTTGGCTATGGAGGGGGGAAGG - Intronic
1070338526 10:75475967-75475989 ATGTGGGAAAGAAGGGAGGGCGG - Intronic
1071110167 10:82146684-82146706 GTTGGGGTATGGAAGGAGGTGGG + Intronic
1072378952 10:94847222-94847244 GTTTTGGGGTGGAGGGAGGGAGG - Intronic
1072500130 10:96007172-96007194 ATTGGAGTGTGGAGGGTGGGAGG - Intronic
1072921794 10:99583027-99583049 AGTTGGGTTTGGTGGGAGGAGGG + Intergenic
1073192304 10:101660319-101660341 AGTTGGGTTGGGAGGGGGGGTGG + Intronic
1074230715 10:111532262-111532284 ATTAGGGGAGGGAGTGAGGGTGG - Intergenic
1074488847 10:113919687-113919709 ATTTGGGGAAGGGGGTAGGGAGG + Intergenic
1075258066 10:120940731-120940753 AGGTGGGTGTGGCGGGAGGGAGG - Intergenic
1075539821 10:123302754-123302776 TTTTGGGTATGGTGTGAGGTAGG - Intergenic
1075656289 10:124163315-124163337 TAATGGGGATGGAGGGAGGGAGG + Intergenic
1076097393 10:127742983-127743005 CTTTAGGTATGGAGGGTAGGGGG - Intergenic
1076102999 10:127797729-127797751 TGTTTGGGATGGAGGGAGGGTGG - Intergenic
1076231900 10:128826933-128826955 ATTTTGAGATGGAGGAAGGGAGG - Intergenic
1076372844 10:129966073-129966095 AGTTGGCCATCGAGGGAGGGTGG + Intergenic
1077283158 11:1754496-1754518 ATGTGGGGATGGAGGGATGGAGG + Intronic
1077538241 11:3134605-3134627 CTTTTGGAAAGGAGGGAGGGAGG + Intronic
1077742760 11:4865553-4865575 ATTTGGCAATGGTGGGAGAGTGG - Intronic
1077953448 11:6987854-6987876 ATTTCAGCATGGAGGGAGGAAGG + Intergenic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1078524326 11:12089154-12089176 AAGTGGGTATGCAGGGAGGCTGG - Intergenic
1078746130 11:14116406-14116428 ATTTGTGTATGGTGTGAGGTAGG + Intronic
1078846388 11:15122630-15122652 ATATGGGTTTTGAGGGAGAGAGG - Intronic
1078849323 11:15149643-15149665 AGTTGGGCAATGAGGGAGGGTGG + Intronic
1078996565 11:16706679-16706701 AGTTGGGTCTGGAGGGGGAGAGG + Intronic
1079362457 11:19780354-19780376 ACTAGGGTGTGGAGGGAAGGTGG - Intronic
1080605363 11:33860818-33860840 AGTTGGGTAGGGAAGGAGGAGGG - Intronic
1081575828 11:44318079-44318101 AGTGGGGAAAGGAGGGAGGGAGG - Intergenic
1081655824 11:44856833-44856855 AAGTGTGTAGGGAGGGAGGGAGG - Intronic
1083259953 11:61517513-61517535 ATTGGGGGATGGAGGGGTGGAGG + Intronic
1083347383 11:62003072-62003094 ACTTGGGTTTGGATGGAGTGAGG + Intergenic
1083592657 11:63904568-63904590 GTTTGGGAAGGGAGGGAGGGAGG - Intronic
1084006188 11:66324897-66324919 ATTTAGGCGTGGAGGGAGGTGGG - Intergenic
1084067809 11:66715390-66715412 CTTTGGCTGTGGAGGGACGGGGG + Exonic
1084462988 11:69306637-69306659 ATTAGGGAATGGAGGGAGCAAGG - Intronic
1084480994 11:69420084-69420106 ATTTGGGGACCAAGGGAGGGAGG - Intergenic
1084739926 11:71133133-71133155 ATGAGTGGATGGAGGGAGGGAGG + Intronic
1085263315 11:75221207-75221229 ATTGGAGGATGGAGGGTGGGAGG - Intergenic
1085568896 11:77541881-77541903 AGTTGGATATGGGGGGAGGCTGG + Intronic
1085655420 11:78310151-78310173 ATGTGGGGGTGGAGGGAGTGAGG + Intronic
1085728393 11:78975166-78975188 ATTGGGGTATGGGGGTAGGGTGG + Intronic
1085737589 11:79052629-79052651 ATGTGGCGAGGGAGGGAGGGAGG + Intronic
1085787596 11:79468758-79468780 ACTTGAGGGTGGAGGGAGGGAGG + Intergenic
1085790054 11:79489452-79489474 ACTTGAGGGTGGAGGGAGGGAGG - Intergenic
1085844383 11:80048892-80048914 ATTGGAGTAGGGAAGGAGGGTGG + Intergenic
1086431395 11:86740137-86740159 ATCTGGGTATTGGAGGAGGGGGG - Intergenic
1086496104 11:87405953-87405975 TTTTGGATATGGAGGAAGGTAGG + Intergenic
1086731830 11:90259561-90259583 ATTTGAGGATGAAGGGAGGAAGG + Intergenic
1087095031 11:94309817-94309839 ATTTGGGAGTGGTGGGAGAGAGG + Intergenic
1087701277 11:101439467-101439489 ATTTGAGGGTGGAGGGTGGGAGG + Intergenic
1088015727 11:105057093-105057115 TTTTGTGTGTGGAGGGATGGAGG - Intronic
1088140748 11:106613237-106613259 AATTGGGACTGGAGGTAGGGAGG + Intergenic
1088476954 11:110250423-110250445 CCTTGGGAAAGGAGGGAGGGAGG - Intronic
1088786822 11:113189763-113189785 AGTTGGGTTTGGATTGAGGGAGG + Intronic
1089155334 11:116397708-116397730 AGTTGAGGAGGGAGGGAGGGAGG + Intergenic
1089492142 11:118890483-118890505 ATTCGGCTTTGGAGGAAGGGTGG + Intronic
1089676706 11:120095348-120095370 ATATGGGTATGGGGTGAGGGAGG + Intergenic
1090028169 11:123185252-123185274 AGTTGGGGAGGGAGGGAGAGAGG + Intronic
1090741477 11:129665526-129665548 ATTAGAGGATGGAGGGTGGGAGG - Intergenic
1090863494 11:130674864-130674886 ATTTGGGGATGGAAGGATGGTGG + Intronic
1090915443 11:131158638-131158660 ATAGGGGTAAGGAGAGAGGGAGG - Intergenic
1091665157 12:2413670-2413692 ATGAGGTTATGGAGGGACGGCGG - Intronic
1091874413 12:3921643-3921665 ATTTCTGTGTGGCGGGAGGGTGG + Intergenic
1092002968 12:5046123-5046145 ATGGGGGGATCGAGGGAGGGAGG - Exonic
1092004452 12:5057366-5057388 AGATGGGTGTGGAGGGATGGAGG + Intergenic
1092069885 12:5623867-5623889 ATTTGGGAATGGGGGGTGGGTGG + Intronic
1092113327 12:5980205-5980227 AGGTAGGTAGGGAGGGAGGGAGG + Intronic
1092288090 12:7141439-7141461 ATTTGGGAAGGGAGGTAGGCTGG + Intronic
1093019639 12:14191458-14191480 GCTTGAGTTTGGAGGGAGGGAGG + Intergenic
1094043385 12:26141267-26141289 GTTTGGGGATGGAGGAAGGGAGG + Intronic
1094462965 12:30717889-30717911 ATTTTAGTATGGAGGTAGGAGGG - Intronic
1095194712 12:39299946-39299968 ATTTGAGGGTGGAGGGTGGGAGG + Intronic
1095528553 12:43157439-43157461 ATCTGGAAATGGAGGGAAGGTGG + Intergenic
1095589351 12:43886779-43886801 TTCTGGGGATGGAGGGTGGGAGG - Intronic
1096179753 12:49544147-49544169 ATGCGGGGAGGGAGGGAGGGAGG - Intronic
1096532210 12:52249219-52249241 CTCTGGGCATGGGGGGAGGGAGG - Intronic
1096677204 12:53232250-53232272 AGTTGGGCAGGGAGGGAGGTTGG - Exonic
1096792792 12:54055241-54055263 ATTTGTGTGTGAGGGGAGGGTGG - Exonic
1097318066 12:58194490-58194512 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
1097376248 12:58846441-58846463 ATTTGGGCATAGATGGAGGTAGG + Intergenic
1097926936 12:65139276-65139298 TTTGGGGGATGGAGGGATGGGGG - Intergenic
1098283189 12:68882235-68882257 ACTTGAGGATGGAGGGTGGGAGG - Intronic
1098827223 12:75311430-75311452 ATTTGGTCATGGAGGAAGAGAGG + Intronic
1099238237 12:80107942-80107964 ATTTGAGAGTGGAGGGTGGGAGG + Intergenic
1099447027 12:82764958-82764980 ATTTGTGTCTGGTGGGCGGGGGG + Intronic
1099620270 12:84995194-84995216 AGGTAGGTAGGGAGGGAGGGAGG + Intergenic
1100391338 12:94148482-94148504 AGATGGGCGTGGAGGGAGGGCGG + Intergenic
1101264820 12:103073172-103073194 ATTGGAGGATGGAGGGTGGGAGG + Intergenic
1101470947 12:104996515-104996537 ACTTGAGGATGGAGGGTGGGAGG - Intronic
1101682558 12:106983965-106983987 AGGTGGGTATGGAGGTAGGTGGG - Intronic
1101952413 12:109187058-109187080 AAAGGGGGATGGAGGGAGGGAGG + Intronic
1102033370 12:109757497-109757519 TTTTGGGTATGGTGTGAGGTAGG - Intronic
1102581324 12:113890116-113890138 TTTTGGGCAGCGAGGGAGGGGGG - Intronic
1102711908 12:114935615-114935637 GTTTGGGTATGGACATAGGGTGG - Intergenic
1102754163 12:115323303-115323325 AGGTAGGTAGGGAGGGAGGGAGG + Intergenic
1102877321 12:116458526-116458548 ATGGGGGTATGGGGGGTGGGGGG - Intergenic
1103140671 12:118545443-118545465 AATTGGGGGTGGGGGGAGGGGGG - Intergenic
1103288328 12:119822047-119822069 TTTTGGTGATGGAGGGAGGTTGG - Intronic
1103304587 12:119953860-119953882 AATAGGGGATGGAGGGAGGGAGG + Intergenic
1103947161 12:124532961-124532983 AGTGGGATTTGGAGGGAGGGGGG - Intronic
1104191078 12:126482445-126482467 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
1104221713 12:126790920-126790942 AATTGAGGATGGAGGGCGGGAGG + Intergenic
1104737722 12:131148356-131148378 ACTTGAGAGTGGAGGGAGGGAGG - Intergenic
1106939219 13:34758435-34758457 ATTTGTGTATGGGGTGAGGTAGG + Intergenic
1107476724 13:40744195-40744217 ATTTGAGGGTGGAGGGTGGGAGG + Intronic
1108759689 13:53547630-53547652 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1108917199 13:55629731-55629753 ACTTGTGGATGGAGGGAGAGAGG - Intergenic
1109371375 13:61424464-61424486 ATTTGGGGAAGGAGAGAGGATGG + Intronic
1109915560 13:68981097-68981119 ACTTGAGTGTGGAGGGTGGGAGG + Intergenic
1110523322 13:76506236-76506258 ACTTGAGGGTGGAGGGAGGGAGG + Intergenic
1110533698 13:76626891-76626913 ATGTGGGTTTGAAGGTAGGGAGG - Intergenic
1110754912 13:79161505-79161527 CTTATAGTATGGAGGGAGGGGGG + Intergenic
1110872695 13:80470841-80470863 TTTTGTGTATGGAGGTAGAGAGG + Intergenic
1111172410 13:84544875-84544897 ATTTGGGCAAGGGGGGAGGTAGG - Intergenic
1111955706 13:94756040-94756062 ACTTGAGGATGGAGAGAGGGAGG - Intergenic
1111960889 13:94808854-94808876 ATTTAGGTGTGTGGGGAGGGTGG + Intergenic
1112066229 13:95795988-95796010 ATTTGGGCCTGGGGGTAGGGAGG - Intergenic
1112439334 13:99414493-99414515 GTTTGGGTATGTAGGGTGAGTGG - Intergenic
1112958434 13:105090864-105090886 ATTTGATGATGGAGGGTGGGAGG - Intergenic
1113068657 13:106396506-106396528 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1113952088 13:114077655-114077677 CGTTGGGCAGGGAGGGAGGGAGG - Intronic
1114159672 14:20150401-20150423 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
1114276871 14:21154622-21154644 AGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1114519353 14:23323162-23323184 TTTTGGGTGTGGAGGGAGTGTGG + Intronic
1114686916 14:24541773-24541795 ACTTAAGTGTGGAGGGAGGGTGG + Intergenic
1115188574 14:30721419-30721441 AATGGGGAAGGGAGGGAGGGAGG - Intronic
1115233778 14:31188858-31188880 AGTTGTGTATGGAGGGATGGGGG - Intronic
1115409240 14:33053796-33053818 TTTTGGGTAGAGAGGAAGGGGGG - Intronic
1116136749 14:40934575-40934597 ATTGGGGGATGGAGGGTGGCAGG - Intergenic
1116625932 14:47263317-47263339 TTTTGGGGATGGAGGATGGGTGG - Intronic
1116736219 14:48695517-48695539 ATTTGAGGGTGGAGGGTGGGAGG + Intergenic
1117001108 14:51372371-51372393 ATTGGAGCATGGAGGGTGGGAGG - Intergenic
1117752044 14:58934620-58934642 ACTTGAGGATGGAGGGTGGGTGG - Intergenic
1117913170 14:60653281-60653303 ATTTATGTATGTATGGAGGGAGG + Intronic
1118075065 14:62289129-62289151 ATTGGGGGATGGTGGCAGGGAGG + Intergenic
1118897431 14:69956743-69956765 AGTTGGGGTTGGAGGTAGGGAGG - Intronic
1119055056 14:71410906-71410928 AGACAGGTATGGAGGGAGGGGGG - Intronic
1119390732 14:74289583-74289605 AGTGGGTTCTGGAGGGAGGGTGG - Intronic
1120097709 14:80407660-80407682 TTTTGTGTATGGTGTGAGGGAGG - Intergenic
1120831359 14:89000431-89000453 ATTGGGGTATTGGGGGTGGGGGG - Intergenic
1120885616 14:89449777-89449799 AGTTGAGGAGGGAGGGAGGGGGG - Intronic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1120995112 14:90411641-90411663 ATTAGGGGATGGGGGGAAGGAGG - Intergenic
1121121230 14:91376990-91377012 AGTTGGTTAGGGAGGGGGGGCGG - Intronic
1121331524 14:93052704-93052726 ACCTGGGTTTGGAGGGAGGGTGG - Intronic
1121747422 14:96309025-96309047 ATTTAGGTATGTAAAGAGGGAGG - Intronic
1121798027 14:96751878-96751900 ACTTGGGGGTGGAGGGTGGGAGG + Intergenic
1121894508 14:97634014-97634036 ATTTGTGGAGGGAGGGAGGAAGG + Intergenic
1122650672 14:103224821-103224843 ATTTGGGCTTGGGGGGCGGGAGG - Intergenic
1122855759 14:104559420-104559442 AGATGGGGATGGAGGGAGGCCGG - Intronic
1123217857 14:106828791-106828813 ACTTGAGTGTGGAGGGTGGGAGG + Intergenic
1123979262 15:25584594-25584616 AGTTGAGAGTGGAGGGAGGGAGG - Intergenic
1124270695 15:28277865-28277887 GTTTTGGTATGGAGCCAGGGTGG - Intronic
1124530434 15:30500750-30500772 ATTTGTGTCTGGAGGGCAGGGGG - Intergenic
1124651563 15:31477881-31477903 AGGTGGGTAGGGAGGGAGGGTGG + Exonic
1124768225 15:32506938-32506960 ATTTGTGTCTGGAGGGCAGGGGG + Intergenic
1125475591 15:40046205-40046227 ATTTTGATGGGGAGGGAGGGAGG - Intergenic
1125511312 15:40293945-40293967 CTTTGGCTAGGGAGGGAGGTGGG - Intronic
1126173460 15:45713340-45713362 ATGGAGGGATGGAGGGAGGGAGG - Intergenic
1126253234 15:46593486-46593508 ATTGGAGAATGGAAGGAGGGAGG - Intergenic
1126991947 15:54388199-54388221 ATTTTGGTCTGGAGGAAGGAAGG - Intronic
1127221435 15:56885228-56885250 ATTGTGAGATGGAGGGAGGGAGG + Intronic
1127295643 15:57606574-57606596 ATTGTGGGATGGGGGGAGGGGGG + Intronic
1127732121 15:61811019-61811041 ATTTGTGGAGGGTGGGAGGGCGG - Intergenic
1127857895 15:62967558-62967580 AATTGGGTAAGGTGGGAGGAAGG - Intergenic
1128283347 15:66415503-66415525 ATCTGGATATGGGGGGAGGGAGG - Intronic
1128520073 15:68369373-68369395 AGTTGGGTGGGGAGGGTGGGAGG + Intronic
1129156766 15:73722957-73722979 ATTTGTGTAAGGAGGGTAGGTGG - Intergenic
1129384091 15:75185978-75186000 AAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1129797539 15:78389470-78389492 AGCTGGGGAAGGAGGGAGGGCGG + Intergenic
1130368889 15:83266252-83266274 GTGTGGGGAGGGAGGGAGGGAGG + Intronic
1131112519 15:89774336-89774358 ATTTGAGTAGGGAGAGAGGCAGG - Intronic
1131295506 15:91145133-91145155 ATTGGAGGATGGAGGGTGGGAGG - Intronic
1131308008 15:91262607-91262629 ACTTGGGGGTGGAGGGTGGGAGG - Intronic
1132040804 15:98523308-98523330 AATTGGTGATGGAGGGAGGGCGG - Intergenic
1132041024 15:98524729-98524751 ATTTGGATTTGCAGGGAGGGGGG + Intergenic
1132088040 15:98923823-98923845 ATTTGGGTTCCCAGGGAGGGAGG - Intronic
1132302766 15:100786805-100786827 ATGTGGATATGGAGAGAGGGCGG + Intergenic
1132384893 15:101393367-101393389 ATCTGGGAATGGCGGGAGAGAGG - Exonic
1132933008 16:2468262-2468284 ATTTGGGGATGGGGTGTGGGGGG - Intergenic
1133378243 16:5307379-5307401 ATTTTTAAATGGAGGGAGGGAGG - Intergenic
1133460551 16:5983258-5983280 AATTGGGTAATTAGGGAGGGTGG + Intergenic
1133589136 16:7225750-7225772 ATTTGGGGGTGGGGGGAGGGGGG + Intronic
1133613161 16:7451926-7451948 ATCTGGGTATGGAATGAGGTGGG + Intronic
1133975125 16:10595047-10595069 ATTCCTGTATGGAGGGAGGTTGG + Intergenic
1134408812 16:13985994-13986016 ATTTGGGGATGGAAGAAGAGTGG + Intergenic
1135586131 16:23672501-23672523 GTTTTGGTAGGGAGGGAGGGAGG + Exonic
1135705414 16:24670804-24670826 GCTTGGGTCTGAAGGGAGGGTGG + Intergenic
1135898221 16:26429924-26429946 AATGGGGGAGGGAGGGAGGGAGG + Intergenic
1135997600 16:27263539-27263561 ATTTGAGGATGGAGGGTGGGAGG + Intronic
1136388108 16:29943050-29943072 GTTTGGGCATAGAGGGAGGTGGG + Intronic
1137055252 16:35742814-35742836 CTTTGGGTTGGGAGGAAGGGTGG + Intergenic
1137357684 16:47782377-47782399 ATTTGGGGGTGGAGGGTGGGAGG - Intergenic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1137673214 16:50291341-50291363 CTCTGGGGGTGGAGGGAGGGCGG + Intronic
1137805065 16:51297240-51297262 ATTTGGGCATGAATGAAGGGTGG + Intergenic
1137858123 16:51817345-51817367 ACTTGAGGATGGAGGGAAGGAGG - Intergenic
1137944878 16:52724224-52724246 ACTTGAGCATGGAGGGTGGGAGG - Intergenic
1138115865 16:54359936-54359958 ACTTGGGTGTGCTGGGAGGGGGG + Intergenic
1138121827 16:54406273-54406295 ATTAGGGAATGGAGGGTGGGAGG + Intergenic
1138714055 16:59001632-59001654 GTTGTGGGATGGAGGGAGGGGGG - Intergenic
1139917400 16:70437275-70437297 ACTTGAGAATGGAGGAAGGGAGG - Intronic
1140026446 16:71294764-71294786 ATTTTGGTATGCTGGTAGGGAGG + Intergenic
1140219559 16:73033706-73033728 ATTTGGGTTTGGAGGGAGGGAGG - Intronic
1140425595 16:74858596-74858618 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
1140857810 16:78993258-78993280 ATTTGGGGGTGGGGGGAGGTTGG + Intronic
1141113075 16:81286357-81286379 CTTGGGGTATGGAGGGGTGGAGG - Intronic
1141296691 16:82776244-82776266 ATTAAGGGAGGGAGGGAGGGAGG + Intronic
1141311666 16:82919356-82919378 ATTTGAGGGTGGAGGGTGGGAGG - Intronic
1141380598 16:83573189-83573211 ATTTGGGGAGGTAGGGAGGAAGG + Intronic
1141487409 16:84349886-84349908 ATTGGGGGAGGGAGAGAGGGAGG + Intergenic
1141635382 16:85311497-85311519 CATTGGGGAGGGAGGGAGGGAGG + Intergenic
1141790119 16:86228697-86228719 AGGTAGGTAGGGAGGGAGGGAGG - Intergenic
1141888147 16:86907341-86907363 ATTTAGGGCTGGAGGGAGGGTGG - Intergenic
1141898264 16:86972514-86972536 ATGCAGGGATGGAGGGAGGGAGG + Intergenic
1142235382 16:88920065-88920087 ATCTGGGGAAGGAGGGAGGCAGG - Intronic
1142330598 16:89450172-89450194 ATTTGGGTATGGAGGTTAAGAGG - Intronic
1143332876 17:6150340-6150362 AAGTGGGTGTGGAGAGAGGGAGG + Intergenic
1143622852 17:8090959-8090981 GGTTGGGTGGGGAGGGAGGGAGG + Intergenic
1143880519 17:10026325-10026347 ATCTGGGTGTGGGGGGAGTGGGG - Intronic
1144135527 17:12291341-12291363 ATTTGGAAAGGGAGGCAGGGAGG + Intergenic
1144532747 17:16055520-16055542 ATTGGAGGATGGAGGGTGGGAGG + Intronic
1144802910 17:17943465-17943487 ACTTGGGTATGGAGAGAATGTGG + Intronic
1145124744 17:20291032-20291054 ATTTGGGAAGGGAGCGAGGAAGG + Intronic
1145960704 17:28885095-28885117 GTGTGGGTATGGAAGGAGAGAGG + Intronic
1146396845 17:32474803-32474825 ACTTCGGTATGCAGGGAGGCAGG + Exonic
1146481188 17:33206287-33206309 TTCTGGGATTGGAGGGAGGGAGG + Intronic
1147273143 17:39291343-39291365 TTTTTGGTAGGTAGGGAGGGAGG + Intronic
1147791049 17:43014495-43014517 ATTTGGGCATGGAAAGAGGCAGG + Intergenic
1147976172 17:44249476-44249498 ATTTGGATAGGGAGTGGGGGAGG - Exonic
1149007525 17:51821126-51821148 ATATTGGGAGGGAGGGAGGGAGG - Intronic
1149126858 17:53245130-53245152 ATTTGTGTGCGGGGGGAGGGAGG - Intergenic
1149456080 17:56789652-56789674 GTTTGTGGATGGGGGGAGGGCGG + Intergenic
1149660148 17:58330598-58330620 GTTTGGGTATGTAGGGGGGCAGG + Intergenic
1149982843 17:61325094-61325116 ATTTGGCAGTGGAGGGAGCGGGG - Intronic
1150594668 17:66593550-66593572 ACTTGGGGGTGGAGGGAGGAGGG + Intronic
1150631268 17:66882034-66882056 GCTGGGGAATGGAGGGAGGGAGG + Intronic
1151530123 17:74698701-74698723 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1151833562 17:76569487-76569509 ATTTGGGGTGGGAGGGTGGGAGG + Intronic
1152026781 17:77815102-77815124 AAGTGGGGAGGGAGGGAGGGAGG - Intergenic
1152197864 17:78928154-78928176 ATTTGTTGATGGATGGAGGGAGG - Intergenic
1152227658 17:79100062-79100084 ATCAGGGAATGGAGGGAGGTGGG - Intronic
1152444560 17:80333994-80334016 ATCTAGGCATTGAGGGAGGGTGG + Intronic
1152473719 17:80504106-80504128 ATGTGTGGATGGAGGGATGGTGG + Intergenic
1152972870 18:181888-181910 TTTTATGTATGGTGGGAGGGAGG + Intronic
1153051268 18:905316-905338 TTTTGGGGTTGGAGGGTGGGAGG + Exonic
1153061328 18:997972-997994 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
1153301297 18:3594353-3594375 CTTTTGGTTGGGAGGGAGGGAGG - Intronic
1153329151 18:3855276-3855298 ACTTGAGGGTGGAGGGAGGGAGG + Intronic
1153410526 18:4787872-4787894 AGTTGGGAGTGGAGGGAGAGTGG + Intergenic
1153483476 18:5571772-5571794 ATTTGGGAATGGAGGAAGGGTGG - Intronic
1153790716 18:8577076-8577098 ATAAGGGGATGGAGGGATGGAGG - Intergenic
1155095336 18:22549856-22549878 ATGTGGGAAGGGAGGGAGAGAGG + Intergenic
1155284020 18:24270936-24270958 TTCTGGGTTTGGAGAGAGGGTGG - Intronic
1155297229 18:24396678-24396700 CTTGGGGTGGGGAGGGAGGGGGG + Intronic
1155595424 18:27480579-27480601 ATTTGGGAATGGAGGGAAACCGG + Intergenic
1155803141 18:30134114-30134136 AGTTGGGGAGGGAAGGAGGGGGG + Intergenic
1155931278 18:31711403-31711425 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1155999515 18:32369516-32369538 ATATGGAGATGGATGGAGGGAGG + Intronic
1156258860 18:35425976-35425998 ACTTGAGGGTGGAGGGAGGGAGG + Intergenic
1157092486 18:44652549-44652571 ATTTGGGGTTGGGGGAAGGGTGG + Intergenic
1157120139 18:44901541-44901563 CTTTGGGTATGATGGGAGGTAGG + Intronic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1158215827 18:55099707-55099729 ATTTGGATATGGAGGGAATGAGG - Intergenic
1159217982 18:65421951-65421973 ATTGTGGAATGGTGGGAGGGGGG - Intergenic
1159951877 18:74489999-74490021 ATGTAGGGAGGGAGGGAGGGAGG + Intergenic
1160058615 18:75509545-75509567 AGTTGGGAATGGTGGGAGCGAGG + Intergenic
1160095103 18:75864045-75864067 GTATGGACATGGAGGGAGGGTGG + Intergenic
1160671781 19:368468-368490 CTCTGGGGAGGGAGGGAGGGAGG + Intronic
1161329039 19:3677815-3677837 ATGGAGGGATGGAGGGAGGGAGG + Intronic
1161439991 19:4285555-4285577 ACTCGGGGAGGGAGGGAGGGAGG - Intronic
1161876004 19:6910298-6910320 ATTTGGGTGGAGCGGGAGGGGGG - Intronic
1162865319 19:13541622-13541644 AGTATGGGATGGAGGGAGGGAGG + Intronic
1163633293 19:18427653-18427675 ATCTGGGCAGGGAGGGAGTGGGG - Intronic
1164025353 19:21346646-21346668 AAGGGGGTAGGGAGGGAGGGAGG + Intergenic
1165386317 19:35512536-35512558 ATGTGGGCTTGGAGGGAGGGAGG + Intronic
1165706898 19:37982769-37982791 ATGTGGCTGTGGAGGGAGAGAGG + Intronic
1166043250 19:40215405-40215427 TATTGGGGAAGGAGGGAGGGGGG + Exonic
1166062417 19:40334951-40334973 AGGGGGGTAGGGAGGGAGGGAGG + Intronic
1166398661 19:42461707-42461729 ATTAGGGTGGGGAGGGAGGAGGG - Intergenic
1166730965 19:45058893-45058915 ATGGGTGGATGGAGGGAGGGAGG - Intronic
1166816087 19:45547069-45547091 CTATGGGGAAGGAGGGAGGGAGG + Intronic
1167243236 19:48357915-48357937 ATTTGGGGACTCAGGGAGGGGGG + Intronic
1167574562 19:50311961-50311983 ATTTTGGTGGGGAGTGAGGGTGG + Intronic
1167577870 19:50326402-50326424 ATTTGGGGTTGGATGGGGGGAGG - Intronic
1168078802 19:53994372-53994394 ATTTGGGAAAGGAGGGAGTATGG - Intronic
1168438277 19:56340027-56340049 TTTTGGGTTTGGATGGAGGAGGG - Intronic
1168705063 19:58465900-58465922 AGGTAGGTATAGAGGGAGGGAGG + Intergenic
925191670 2:1889723-1889745 ATAGGGAAATGGAGGGAGGGAGG - Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925334036 2:3080129-3080151 GTTTGGGGGTGGAGAGAGGGAGG + Intergenic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
925589462 2:5494946-5494968 ATTTGGGGGTGTAGGGTGGGAGG - Intergenic
925617286 2:5755689-5755711 GTTGGGGTGTGGAGGGAGTGGGG + Intergenic
926044727 2:9702053-9702075 TTTTGGATATGGTGTGAGGGAGG + Intergenic
926045454 2:9706448-9706470 ATTTGGGTCTGGAGGGCCAGTGG + Intergenic
926498833 2:13627049-13627071 GTTGTGGGATGGAGGGAGGGGGG - Intergenic
927272801 2:21231523-21231545 ATCTGTTTATGGAGAGAGGGAGG + Intergenic
927352133 2:22128099-22128121 ATTTGTGTCTGGTGGGAAGGGGG - Intergenic
928126366 2:28619397-28619419 ATGTGGGTGAGGAGGGAGTGTGG + Intronic
928498600 2:31862940-31862962 AGGTGGGGAGGGAGGGAGGGAGG + Intergenic
928659543 2:33487446-33487468 ATTTGGGTGTGCAGGAAAGGAGG + Intronic
929207945 2:39319479-39319501 ATTTGGGTATGCACGGAGTTTGG + Intronic
929333746 2:40714999-40715021 TTTAGGGTGTGGGGGGAGGGGGG - Intergenic
929546546 2:42858532-42858554 ACTTGGGTGTGGAGGGAGCAGGG + Intergenic
930347068 2:50196903-50196925 ATTTGAGGGTGGAGGGTGGGAGG + Intronic
930365429 2:50433715-50433737 AGTTGGGGAGGGAGGGAAGGTGG + Intronic
930572723 2:53107418-53107440 ATTGGAGGGTGGAGGGAGGGAGG + Intergenic
930694201 2:54394696-54394718 ATGTGTGGAGGGAGGGAGGGAGG - Intergenic
931014673 2:57962567-57962589 ACTTGAGGATGGAGGGAGGGAGG - Intronic
931391676 2:61849966-61849988 AGGTGGGGAGGGAGGGAGGGAGG + Intronic
931617993 2:64180932-64180954 ATTTGGGGTTGGAGTCAGGGTGG + Intergenic
931929871 2:67119684-67119706 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
931951076 2:67362098-67362120 GTTTTGGTGTGGGGGGAGGGGGG + Intergenic
932359691 2:71093757-71093779 ATTTGTGGCTGGGGGGAGGGTGG - Intergenic
932574096 2:72953371-72953393 ATTTGAGACTGGAGGGAAGGAGG + Intronic
932755649 2:74407436-74407458 ATTTGGGAGTGGAAGGTGGGAGG - Intergenic
933103676 2:78293480-78293502 ATGTAGGTAGGGAGGCAGGGAGG - Intergenic
935225741 2:101050906-101050928 ATTTGAGGGTGGAGGGTGGGAGG - Intronic
935472615 2:103478511-103478533 AGTGGGGGATGGCGGGAGGGTGG + Intergenic
936544099 2:113375253-113375275 ATTTGGGGAAGGAGGCAGTGTGG - Intergenic
937358194 2:121211582-121211604 GTTTGGGAATGGGGGGCGGGAGG + Intergenic
937805468 2:126138259-126138281 ATTTGGGTATGTGTGGAGGCTGG + Intergenic
937842030 2:126533866-126533888 ATTTGGGTAAGGAGGTAAGGAGG + Intergenic
938137972 2:128774832-128774854 ACTTTGGGATGGAGGGAGGCTGG + Intergenic
938631556 2:133173178-133173200 ATTTGGGGATGGCAGGAGGTTGG + Intronic
938789761 2:134666254-134666276 ATTTGGGGGTTGGGGGAGGGTGG - Intronic
938950990 2:136254322-136254344 ATTTTGGAGTGGGGGGAGGGAGG - Intergenic
939010266 2:136838269-136838291 AATTGGGTATAGAGGGAAGGAGG + Intronic
939111079 2:138008135-138008157 ACTTGAGGATGGAGGGTGGGGGG - Intronic
939480593 2:142742832-142742854 CATTGGGGGTGGAGGGAGGGGGG - Intergenic
939631789 2:144534445-144534467 CTTTGGGGATGCAGGGTGGGAGG - Intergenic
940493093 2:154390374-154390396 ATTGGAGGATGGAGGGTGGGAGG - Intronic
940710772 2:157160898-157160920 TTTTTGGTATCCAGGGAGGGAGG + Intergenic
941274842 2:163478292-163478314 ATTGGGGAGTGGAGGCAGGGAGG - Intergenic
941407533 2:165109683-165109705 ATCTGGCTATGGAGAGGGGGAGG - Intronic
941561855 2:167056801-167056823 ATATGGATATGGAGGGAAGGAGG - Intronic
941927587 2:170911718-170911740 ATTTGGCTATTGTGGGAGGTGGG + Intergenic
942374020 2:175317292-175317314 ATTTGGGGATGGACAGAGGAGGG + Intergenic
942618078 2:177815570-177815592 ATTTTTGAATGGAGGGTGGGAGG - Intronic
942641667 2:178067078-178067100 ATTTGGGAAAGGAGGGAGGGAGG - Intronic
942668802 2:178351834-178351856 ATTTGAGGGTGGAGGGTGGGAGG + Intronic
942805015 2:179920282-179920304 ATTTGAGTGTGGAGGGTGGGAGG - Intergenic
944499506 2:200344219-200344241 ACTTGAGTATGGAGGGTGGAAGG - Intronic
944589128 2:201200892-201200914 ATTGAGGTATTGAGGGAGAGAGG + Intronic
944651743 2:201837403-201837425 AGGTGGGGAGGGAGGGAGGGAGG + Intronic
944732321 2:202529336-202529358 ATTTGGGTATGGAGGGAGGGTGG - Intronic
944762491 2:202831423-202831445 AGTTGGGAGTGGAGGGAAGGAGG - Intronic
945541899 2:211098273-211098295 ACTTGTGGGTGGAGGGAGGGAGG - Intergenic
945674830 2:212843567-212843589 ATTTGTGTTGGGAGGAAGGGTGG - Intergenic
945772241 2:214058718-214058740 ATTTGGATATGGAGAGGGAGAGG - Intronic
946497747 2:220213034-220213056 ATGTGGGGATGGAGGGAGAGAGG + Intergenic
946520874 2:220463552-220463574 ACTTGAGTCTTGAGGGAGGGGGG + Intergenic
947454561 2:230241967-230241989 GTTTGGATATGGAGAGAGAGGGG + Intronic
947541826 2:230985176-230985198 CTTTGGAGATGAAGGGAGGGAGG + Intergenic
947751670 2:232535785-232535807 TCTGGGGTCTGGAGGGAGGGAGG - Exonic
948116635 2:235498305-235498327 ATTTGGGGGTGAAGGGAGGGGGG - Intronic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
948157546 2:235795608-235795630 ATTTGTGTATGGAAGCAGGAAGG + Intronic
948860728 2:240751479-240751501 ATTAGGGTGTGGAGGGAGCAAGG - Intronic
1168974362 20:1953088-1953110 AGAGGGGGATGGAGGGAGGGAGG + Intergenic
1169024636 20:2358853-2358875 ACTTGGGGGTGGAGGGTGGGAGG - Intergenic
1169134906 20:3191302-3191324 ATTTGGCTGTAGTGGGAGGGAGG - Intronic
1170867991 20:20177440-20177462 ATTTCAGGATGGAGGGAGGGTGG - Intronic
1171153491 20:22848714-22848736 ACTTGAAGATGGAGGGAGGGAGG + Intergenic
1171239592 20:23554233-23554255 AGTAGGGTGGGGAGGGAGGGGGG - Intergenic
1171383291 20:24749701-24749723 AGTGGGGGAGGGAGGGAGGGAGG + Intergenic
1171455323 20:25268159-25268181 TTTTGGATATGGGGGGGGGGCGG - Intronic
1172007342 20:31826533-31826555 GTGCGGGTATGGAGGGTGGGTGG + Intronic
1172022089 20:31921819-31921841 ATTTTGGGGTGGAAGGAGGGGGG + Intronic
1172300016 20:33842824-33842846 ATTCAGGCATGGAGGGAAGGAGG - Intronic
1172448605 20:35006210-35006232 TTGTGGGTAGGGAGTGAGGGTGG - Intronic
1172919803 20:38472040-38472062 CCTTGGGTATTGAGAGAGGGAGG - Intergenic
1172988891 20:39017194-39017216 TTTTTGGTATGGAGTGAGGTAGG + Intronic
1173023263 20:39285327-39285349 GTTGGGGCATGGAGTGAGGGTGG + Intergenic
1173166647 20:40690625-40690647 ATCTGGGTAGGGAGGGTGCGCGG - Intergenic
1173374456 20:42470913-42470935 ATGGGGGTATGGAGGTGGGGTGG + Intronic
1173558441 20:43984628-43984650 ATTGGGGAATGGATGGGGGGAGG + Intronic
1173658211 20:44715487-44715509 ATTTGGGTGTGGAGGGGGTGGGG + Intronic
1173830728 20:46085481-46085503 ATGTGTGTATGGAGGGGGTGGGG + Intronic
1173879674 20:46402567-46402589 GCTTGGGTAGGGAGGGAGTGTGG + Intronic
1173943326 20:46930748-46930770 ATTTGGATTTGATGGGAGGGAGG + Intronic
1174308542 20:49632322-49632344 AGTTGGGAATGTAGGGAAGGTGG - Intergenic
1174743302 20:53037843-53037865 AGTTGGGTGTGGAGAGAGGGTGG - Intronic
1175028814 20:55931642-55931664 ATAGGGGGAGGGAGGGAGGGAGG + Intergenic
1175221185 20:57417415-57417437 GTTGGGGAATGGATGGAGGGAGG + Intergenic
1175676410 20:60949895-60949917 ATGGAGGTAGGGAGGGAGGGAGG + Intergenic
1175899464 20:62354342-62354364 GGATGGGTAGGGAGGGAGGGAGG - Intronic
1175984115 20:62755600-62755622 AATGAGGGATGGAGGGAGGGAGG - Intronic
1175984213 20:62755876-62755898 AATGAGGGATGGAGGGAGGGAGG - Intronic
1177166769 21:17612637-17612659 CTGTGGGTATCGGGGGAGGGTGG - Intronic
1177553864 21:22664130-22664152 TTTTGTGTATGGAGTGAGGTAGG - Intergenic
1177957648 21:27619869-27619891 ATTGGGGTAAGGTGTGAGGGAGG + Intergenic
1178956033 21:37022831-37022853 ACTTGAGGATGGAGGGAGGAGGG - Intergenic
1179925617 21:44532504-44532526 TTTGGGGTATGGTGGGAGAGAGG + Intronic
1179976064 21:44867389-44867411 ACTCACGTATGGAGGGAGGGGGG + Intronic
1180172067 21:46064792-46064814 ATGGAGGGATGGAGGGAGGGAGG + Intergenic
1180179296 21:46110948-46110970 ACTTTGATAAGGAGGGAGGGAGG - Intronic
1181438951 22:22925879-22925901 ATGTGGCTAAGGAGTGAGGGAGG + Intergenic
1181528277 22:23502285-23502307 ATCAGGGTATGGAAGGATGGGGG - Intergenic
1181653391 22:24274260-24274282 TTTTGGGTATGTTGAGAGGGAGG + Intronic
1181685518 22:24525200-24525222 CCTTGGGAAAGGAGGGAGGGAGG + Intronic
1181750147 22:24983595-24983617 ATGTGTGTATGGTGGGGGGGCGG + Intronic
1181774194 22:25147983-25148005 AGTGAGGTAGGGAGGGAGGGAGG - Intronic
1181967456 22:26666953-26666975 ATGTGGGGAGGGAGGGAGGGAGG + Intergenic
1182074252 22:27484083-27484105 GTTTGGCTATGGAGGGAAGGAGG - Intergenic
1182200573 22:28564973-28564995 ATTTGGGGGTGGGAGGAGGGAGG + Intronic
1182657687 22:31903380-31903402 ATTTAGGTGTGGAAGGTGGGGGG - Intronic
1182727084 22:32456447-32456469 ATGAGGGAAGGGAGGGAGGGAGG - Intronic
1183001617 22:34864339-34864361 AGGTGTGTATGGAGGGTGGGCGG - Intergenic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
1183598371 22:38825788-38825810 ACCTGGGGATGGAGGGAGGAAGG - Intronic
1183848479 22:40562754-40562776 AGGGGGGAATGGAGGGAGGGAGG + Intronic
1184293171 22:43508923-43508945 AGATGGGGATGGAGGGATGGGGG - Intergenic
1184729122 22:46363553-46363575 TTGTGAGTTTGGAGGGAGGGAGG + Intronic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
1184948813 22:47824427-47824449 ATTGTGGGGTGGAGGGAGGGGGG + Intergenic
1185370509 22:50458834-50458856 ATTGGGGGATGCAGGGAGGGTGG + Intronic
1203322947 22_KI270737v1_random:86267-86289 ATGAGGGAAGGGAGGGAGGGAGG - Intergenic
949650603 3:6154741-6154763 GTTTGGGTATCCAGGGAAGGTGG - Intergenic
949995685 3:9614783-9614805 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
950199101 3:11030241-11030263 ATTTGGATCTGGTGGGGGGGGGG - Intronic
950203853 3:11062951-11062973 AGATGAGTGTGGAGGGAGGGAGG + Intergenic
950696730 3:14706534-14706556 ATTTGGGGGTGGGGGGTGGGAGG - Intronic
950966478 3:17150177-17150199 ATTTGGGGTTGGGGGGTGGGGGG - Intergenic
951406550 3:22306741-22306763 AGCTGGGTATGGAGTAAGGGAGG + Intronic
951568198 3:24034264-24034286 ATTAGGGAGTGGAGGGAGGGAGG + Intergenic
951655337 3:25001105-25001127 GTGTGAGGATGGAGGGAGGGAGG + Intergenic
951679610 3:25281208-25281230 ATTTGGGAATGGAGCCAGTGGGG + Intronic
951937395 3:28036953-28036975 ACTTTGGGATGGAGGGAGAGAGG - Intergenic
952213920 3:31256594-31256616 ATTTAGGTAGGGAGAGAAGGGGG + Intergenic
952255110 3:31688245-31688267 ATTTGTGCAGGGAGGGATGGGGG - Intronic
953039492 3:39242689-39242711 ATTGGAGGATGGAGGGTGGGAGG + Intergenic
953120571 3:40037380-40037402 ATTTAGGAATAGAGGGAGGCAGG + Intronic
953756751 3:45653230-45653252 ATTTGGATGAGGAGGGAGAGAGG + Intronic
953788395 3:45928522-45928544 AAGTGGGTCTGGAGAGAGGGTGG + Intronic
953903717 3:46857767-46857789 AGGTGGGTAGGAAGGGAGGGAGG + Intergenic
953905425 3:46866104-46866126 AGTTGGGGGTGGAGGGAGGGAGG + Intronic
953937978 3:47063029-47063051 ATTTTGGTATGGAGAGAAGGGGG - Intronic
954596255 3:51827808-51827830 ATTTGAGGGTGGAGGGTGGGAGG - Intronic
954954518 3:54507705-54507727 GTCTGGGAATGGAGGGAGGCTGG + Intronic
954995231 3:54875238-54875260 GTTTGGGTTTGGAGGGGGTGGGG - Intronic
955225790 3:57059503-57059525 AGTTGGGGGTGGGGGGAGGGAGG + Intronic
955249650 3:57266762-57266784 TTTTGTGTATGGTGAGAGGGAGG + Intronic
956428144 3:69157905-69157927 ATTAGAGGATGGAAGGAGGGAGG + Intergenic
956731657 3:72202011-72202033 AGCTGGGCATGGATGGAGGGTGG - Intergenic
956933237 3:74070345-74070367 ACTTGGGAGTGGAGGGTGGGAGG + Intergenic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
957244946 3:77704680-77704702 ATTTGGATATGTATGGGGGGAGG + Intergenic
957951326 3:87131163-87131185 ACTTGGGGGTGGAGGGTGGGAGG - Intergenic
958551494 3:95619518-95619540 ACTTGAGGATGGAGGGAGGGAGG + Intergenic
958667374 3:97158793-97158815 ATTTGTGTATGGTGGGCTGGAGG + Intronic
958712713 3:97737506-97737528 GTTTGAATATGGAGGGAGGGAGG + Intronic
958756142 3:98251381-98251403 ATTGGAGGATGGAGGGTGGGAGG + Intergenic
959382351 3:105656611-105656633 ATTTGGGGGTGGGGGGTGGGGGG - Exonic
960291942 3:115896680-115896702 ATTTAGGTATTGAGGAAGTGAGG + Intronic
960307746 3:116082882-116082904 ATTTGAGGGTGGAGGGTGGGAGG + Intronic
960316760 3:116187940-116187962 ATTGGAGGATGGAGGGTGGGAGG - Intronic
960384619 3:117007163-117007185 TTGTGGGGGTGGAGGGAGGGAGG - Intronic
960538148 3:118835487-118835509 CTTTTGCTATGGAGGGAAGGAGG - Intergenic
961259789 3:125593108-125593130 ATTTGGGTCTGGAGAGAGCCGGG - Intronic
961636189 3:128334727-128334749 TTCTGGGGAAGGAGGGAGGGAGG - Intronic
962047931 3:131780664-131780686 ATTTGAGAGTGGAGGGTGGGAGG + Intronic
962168487 3:133076075-133076097 ATTTGGGTAAGGAGGAAGGCAGG + Intronic
962174214 3:133135850-133135872 GTTTGGGAGTGGAGGGAGGGTGG + Intronic
962341606 3:134590082-134590104 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
962409362 3:135127927-135127949 GTTTGGGTGAGGAGGGAGTGTGG - Intronic
962470326 3:135702064-135702086 ATTTGAGAGTGGAGGGTGGGAGG + Intergenic
962988668 3:140558868-140558890 ATTTGAGTTTGTGGGGAGGGTGG + Intronic
963576489 3:147066815-147066837 ATTTGGGGGTGGAGGGCAGGGGG + Intergenic
963579769 3:147110659-147110681 ACTTGAGAATGGAGGGTGGGAGG - Intergenic
963953966 3:151232779-151232801 ACTTGAGGATGGAGGGTGGGAGG + Intronic
964232030 3:154481551-154481573 ATCAGGGGATGGAGGGTGGGAGG + Intergenic
964606936 3:158570309-158570331 ATTTGGATATGGTGGGGCGGAGG - Intergenic
964618322 3:158694426-158694448 ATTGGAGGATGGAGGGTGGGTGG + Intergenic
964859931 3:161190456-161190478 ATTGTGGGATGGGGGGAGGGGGG - Intronic
964968605 3:162530700-162530722 ATTTGAGGGTGGAGGGTGGGAGG + Intergenic
965355403 3:167667221-167667243 AGTTTTGTAGGGAGGGAGGGAGG + Intergenic
966167852 3:177041290-177041312 TTTTTGGGAAGGAGGGAGGGAGG + Intronic
966302032 3:178489901-178489923 TTTTGGGTATGGGTGGAGGTGGG - Intronic
966310105 3:178584428-178584450 TTTTGGAGAGGGAGGGAGGGAGG - Intronic
966311028 3:178594043-178594065 ACTTGGGTAGGTAAGGAGGGAGG - Intronic
966603812 3:181801694-181801716 ACTTGAGTGGGGAGGGAGGGAGG + Intergenic
966663498 3:182444009-182444031 ACTTGAGGATGGAGGGCGGGAGG + Intergenic
966914674 3:184578182-184578204 AATGGGGTATGGAGAAAGGGCGG - Intronic
966950947 3:184817247-184817269 ATTTACCTAGGGAGGGAGGGAGG + Intronic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
967993831 3:195151876-195151898 ATTAAGGGAGGGAGGGAGGGAGG + Intronic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968356020 3:198108050-198108072 AACTGGGGAAGGAGGGAGGGAGG + Intergenic
968887205 4:3341298-3341320 GATGGGGTATGGGGGGAGGGAGG + Intronic
968887234 4:3341366-3341388 ATGGGGGTACGGGGGGAGGGAGG + Intronic
968887298 4:3341528-3341550 ATGGGGGTGTGGGGGGAGGGAGG + Intronic
969015949 4:4104395-4104417 TTTTGGGGGTGGAGGGTGGGGGG - Intergenic
969194397 4:5548993-5549015 ATTCAGGGAGGGAGGGAGGGAGG - Intronic
969462253 4:7334950-7334972 AGACGGGTGTGGAGGGAGGGAGG + Intronic
969690458 4:8701443-8701465 ACTTGGGTGAGGAGAGAGGGAGG - Intergenic
969782579 4:9420575-9420597 ACCTGGGGATGGAGGGTGGGAGG + Intergenic
970224558 4:13844127-13844149 AGATGGGAATGGAGGAAGGGAGG - Intergenic
970379766 4:15495068-15495090 ATTTGAGGGTGGAGGGTGGGAGG - Intronic
970406136 4:15766153-15766175 AGTTGGGGATGGAGGTAGGGTGG + Intergenic
970522380 4:16898770-16898792 AGGTTGGTATGGAGGAAGGGAGG + Exonic
970690539 4:18614916-18614938 ATTTAAGGAGGGAGGGAGGGAGG - Intergenic
970970014 4:21971525-21971547 CTTTGGGTATGGTGGGAGCTGGG + Intergenic
971671129 4:29559336-29559358 TTTTGTGTGTGGAGGGATGGAGG + Intergenic
971734033 4:30423060-30423082 ATTTGAGGATGGAGAGTGGGTGG - Intergenic
971974825 4:33671182-33671204 ATTTGAGAATCTAGGGAGGGTGG + Intergenic
972741689 4:41893220-41893242 CTTGGTGTCTGGAGGGAGGGAGG - Intergenic
973056923 4:45671692-45671714 ATTGGGGGATGGAGGTTGGGAGG - Intergenic
973532435 4:51846145-51846167 TTTGGGGAATGGAGGGAGGTGGG - Intronic
973822892 4:54678361-54678383 ATTGGGGGAGGGAGGGAGGGAGG - Intronic
974427009 4:61754764-61754786 ATTTTGGTGTGGGGGGAGGGGGG - Intronic
974543791 4:63274825-63274847 CATTGAGAATGGAGGGAGGGAGG + Intergenic
975226111 4:71874623-71874645 AGTTGGGAATGGAGAGAGGTTGG - Intergenic
975667784 4:76750508-76750530 ATTTGAGGGTGGAGGGTGGGAGG + Intronic
975817466 4:78233996-78234018 ATTGTGGAATAGAGGGAGGGTGG - Intronic
976672551 4:87669920-87669942 ATGTGGGAATGGCGGGGGGGAGG + Intergenic
976962712 4:90998880-90998902 ACTAGGGCATGGAGGGAGGGAGG - Intronic
977692140 4:99925079-99925101 ATTTTGGTATTCAAGGAGGGAGG - Intronic
978271589 4:106896545-106896567 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
979269790 4:118746222-118746244 GTTGGGGGAGGGAGGGAGGGAGG + Intronic
979991035 4:127375571-127375593 TTTTGTGTATGGTGGAAGGGAGG - Intergenic
980038685 4:127914279-127914301 ATATGGGGAGGGAGGGAGGGAGG - Intergenic
980693309 4:136323703-136323725 ATGTGTGTGTGGAGAGAGGGAGG + Intergenic
980782059 4:137503653-137503675 ATTTGGTTATGGAGTGTAGGAGG + Intergenic
981046876 4:140272802-140272824 ATTTGGGTGGGGAAGGAAGGCGG + Intronic
981241324 4:142479802-142479824 ATTTGAGAATGGAGGGTGGGAGG + Intronic
981928379 4:150164368-150164390 AGTAGGGTATGGGGGTAGGGGGG - Intronic
982285693 4:153731790-153731812 ATTTGTGTGTGGAGGGTGGTGGG + Intronic
982948609 4:161660619-161660641 ATTAGAGCATGGAGGGTGGGAGG - Intronic
982963614 4:161873520-161873542 AGTGTGGGATGGAGGGAGGGTGG - Intronic
983126624 4:163960650-163960672 ACTTGAGTGTGGAGGGTGGGAGG + Intronic
983518190 4:168678805-168678827 ATGTGGGTATGGTGTGTGGGGGG + Intronic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
983639446 4:169931124-169931146 ATTGGAGTGTGGAGGGTGGGAGG + Intergenic
984013889 4:174403365-174403387 ATTTGAGTAAGGATGGATGGAGG + Intergenic
984305242 4:177980998-177981020 ATATGAGGATGGAGGGTGGGAGG - Intronic
984472870 4:180199275-180199297 TTTTGAGTATGGTGTGAGGGAGG - Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985189790 4:187360320-187360342 ATTTGGGGAGGGAAGAAGGGAGG + Intergenic
985485509 5:146268-146290 GTGTGGGAAAGGAGGGAGGGGGG - Intronic
986418936 5:7557521-7557543 ATTGGAGGATGGAGGGTGGGAGG - Intronic
986816219 5:11414746-11414768 ATTTGAGAGTGGAGGGTGGGAGG - Intronic
987735597 5:21838868-21838890 ATGTGGGTATGGATGAAGGCTGG - Intronic
988043026 5:25912086-25912108 ATTTGGGTACTGAAGCAGGGAGG - Intergenic
988672788 5:33399972-33399994 ACTTCTGTATGGAGGCAGGGAGG - Intergenic
989077203 5:37576136-37576158 TTTTAGGGAGGGAGGGAGGGGGG - Intronic
989153695 5:38324377-38324399 ATTGGGGTATGTGTGGAGGGGGG - Intronic
989697717 5:44223157-44223179 ATGAGGGGAGGGAGGGAGGGAGG + Intergenic
989964576 5:50452743-50452765 ATTGGAGTGTGGAGGGTGGGAGG - Intergenic
990007182 5:50957305-50957327 AATTAGGAAGGGAGGGAGGGAGG - Intergenic
990182309 5:53174594-53174616 GTGTGGGAAGGGAGGGAGGGAGG - Intergenic
990251140 5:53916348-53916370 ACTTGAGGATGGAGGGTGGGAGG + Intronic
990442644 5:55861932-55861954 ATATGAGTATAGAGGGAAGGAGG + Intronic
990700325 5:58467956-58467978 AGTTGGGTATGGAAGGAAGAGGG - Intergenic
990769600 5:59228248-59228270 ACTTGAGGATGGAGGGTGGGAGG + Intronic
991086206 5:62650305-62650327 ATTTGGGTTTAGGGGAAGGGAGG + Intergenic
991480343 5:67071359-67071381 TATTTGGTAGGGAGGGAGGGAGG + Intronic
991494572 5:67214684-67214706 AATTGGATATGGAGGGGTGGGGG + Intergenic
992322604 5:75628723-75628745 ATTTGGGTGGGGAGAGATGGAGG + Intronic
992519999 5:77540720-77540742 ATGTAGGGAGGGAGGGAGGGAGG + Intronic
993075610 5:83226356-83226378 CTCTGGGGCTGGAGGGAGGGTGG + Intronic
993213876 5:84993889-84993911 ATTTGGGGGTGGAGGCTGGGAGG - Intergenic
993237482 5:85331921-85331943 ACTTGAGTCTGGAGGGTGGGAGG - Intergenic
993281252 5:85927643-85927665 ATGAAGGTAAGGAGGGAGGGAGG - Intergenic
993350657 5:86845990-86846012 ACTTGAGTGTGGAGGGTGGGAGG - Intergenic
993468097 5:88272357-88272379 ATTCTGGTGCGGAGGGAGGGGGG - Intergenic
993762845 5:91818277-91818299 TTTTAGGTATGGAGGTAAGGAGG + Intergenic
993845383 5:92935984-92936006 TCCTGGGTATGGAGGGAGGTAGG + Intergenic
994618986 5:102140425-102140447 ACTTGAGGGTGGAGGGAGGGAGG - Intergenic
995423600 5:111993844-111993866 ATTTGGGAGTGGAGGAAGGAAGG - Intronic
995612896 5:113929390-113929412 GTTGGGGGGTGGAGGGAGGGGGG - Intergenic
995672246 5:114619174-114619196 ATATGAGGATGGAGGGTGGGAGG + Intergenic
996469408 5:123842735-123842757 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
996923353 5:128794781-128794803 GGTTGGGGGTGGAGGGAGGGGGG - Intronic
997066198 5:130562342-130562364 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
997363984 5:133313624-133313646 ATTTTGGTGTGGGGGGAGGGGGG + Intronic
997372311 5:133369920-133369942 ACCTGGGGAGGGAGGGAGGGAGG - Intronic
997516042 5:134490669-134490691 AGCTGGGTAAGGAGGGAAGGCGG - Intergenic
997877074 5:137559075-137559097 GGTTGGGGAGGGAGGGAGGGAGG + Intronic
997897109 5:137728823-137728845 ACTTGAGGATGGAGGGTGGGTGG + Intronic
998127004 5:139631038-139631060 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
998704309 5:144741072-144741094 ATATATATATGGAGGGAGGGAGG - Intergenic
999451680 5:151683082-151683104 ATTGAGGTTGGGAGGGAGGGAGG + Intronic
999542944 5:152593939-152593961 AATTGGGGATGGAGGGGGGATGG - Intergenic
1000613702 5:163404629-163404651 GTGTGTGTAAGGAGGGAGGGGGG - Intergenic
1000774930 5:165407690-165407712 ATTTGTATATGGAGTAAGGGAGG + Intergenic
1001686397 5:173597716-173597738 ATGGAGGGATGGAGGGAGGGAGG - Intergenic
1002338719 5:178500042-178500064 ACCTGGGAATGGAGAGAGGGTGG + Intronic
1002370060 5:178744820-178744842 ACTGGAGGATGGAGGGAGGGCGG + Intergenic
1002444659 5:179282310-179282332 ATTTGTGTATGGTGTGAGGAAGG + Intronic
1002528446 5:179828887-179828909 AGATGGACATGGAGGGAGGGTGG + Intronic
1002600390 5:180351422-180351444 ATTTGGGGCTGGGGGCAGGGTGG - Intronic
1002717983 5:181240601-181240623 ATTTGGGGATGGGTGGGGGGCGG - Intronic
1003173379 6:3737470-3737492 AGTTGACTATAGAGGGAGGGAGG - Intronic
1003642847 6:7889910-7889932 ATTTGGTGGTGGTGGGAGGGGGG + Intronic
1003687489 6:8318745-8318767 ATGTGTGTATGGAGGGAGAGGGG - Intergenic
1003946264 6:11078810-11078832 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
1004015449 6:11727972-11727994 AGGTAGGTAGGGAGGGAGGGAGG + Intronic
1004031596 6:11875488-11875510 TTGTGGGCTTGGAGGGAGGGCGG - Intergenic
1004265544 6:14145611-14145633 ATTTAGGCAAGGAGGCAGGGAGG - Intergenic
1004351359 6:14893071-14893093 GGTTGGGGATGGAGGGAAGGAGG + Intergenic
1004752839 6:18581583-18581605 AGTGGGGGAGGGAGGGAGGGAGG - Intergenic
1005313307 6:24580315-24580337 ATATGGTTATGGGGGGTGGGGGG - Intronic
1005902522 6:30229587-30229609 ATTTGAGGATGGAGGGTGGAAGG - Intergenic
1006050997 6:31344226-31344248 AGGTGGGCCTGGAGGGAGGGAGG + Intronic
1006266029 6:32924515-32924537 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
1006734494 6:36263337-36263359 ATTTGGGAATGCAGGGCAGGGGG - Intronic
1006871571 6:37256820-37256842 ATTTGGGGAAAGAGGGAAGGCGG - Intronic
1006880237 6:37332598-37332620 ATTTGGTAGTGGAGGGTGGGGGG + Exonic
1006902629 6:37512920-37512942 AGCTGGGTTTGGAGGAAGGGAGG + Intergenic
1007183498 6:39947937-39947959 ATGGGTGTAGGGAGGGAGGGAGG + Intergenic
1007407093 6:41641401-41641423 AGTTGGGTTTGGAGAGTGGGAGG + Intronic
1007515813 6:42410633-42410655 ATGTGGTGATGGAGGGAGGGGGG - Intronic
1007527318 6:42507870-42507892 ATTTGTGACAGGAGGGAGGGGGG - Intergenic
1008124238 6:47650564-47650586 AATGGGGTATGGAGGGGAGGAGG + Intergenic
1008331893 6:50255287-50255309 ATTGGAGGATGGAGGGTGGGAGG - Intergenic
1008659638 6:53652629-53652651 ATTTGAATATGGAGGAAAGGGGG - Intronic
1008709618 6:54208847-54208869 AACTGTGTAGGGAGGGAGGGAGG - Intronic
1009394064 6:63177070-63177092 AATGGGATATAGAGGGAGGGAGG - Intergenic
1009642936 6:66361810-66361832 GTTTTGGGATGGGGGGAGGGGGG - Intergenic
1010096814 6:72056257-72056279 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1010462968 6:76134083-76134105 GGTTAGGTCTGGAGGGAGGGAGG + Intergenic
1010477310 6:76303882-76303904 ACTTGAGTGTGGAGGGAGGAGGG - Intergenic
1010507221 6:76675405-76675427 ATTTGAGGGTAGAGGGAGGGAGG - Intergenic
1010659441 6:78552439-78552461 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1010918598 6:81652050-81652072 CTTGGGGGATGGAGGGTGGGAGG - Intronic
1011493375 6:87915348-87915370 ATGTGTGTGTGGAGGGTGGGAGG + Intergenic
1011628907 6:89305793-89305815 ACTTGAGTGTGGAGGGTGGGAGG + Intronic
1011878816 6:91997080-91997102 ATTGGAGTGTGGAGGGTGGGAGG + Intergenic
1012599963 6:101083512-101083534 AGTTGGGAAAGGAGGGAGGTGGG + Intergenic
1013421739 6:109973150-109973172 ATTTGAGGATGCAGGGTGGGAGG + Intergenic
1013832085 6:114285286-114285308 ATTGGAGGATGGAGGGTGGGAGG + Intronic
1014340077 6:120193493-120193515 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
1015315837 6:131815096-131815118 ATTTGGGTATAGGGAGATGGAGG + Intronic
1015480964 6:133709014-133709036 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1015555412 6:134456346-134456368 ATTTGAATATGGAGGCAGTGAGG + Intergenic
1016432576 6:144003230-144003252 TTTTGTGTATGGTGTGAGGGGGG - Intronic
1016440930 6:144082621-144082643 AAGTGGGTGTGGGGGGAGGGGGG + Intergenic
1016519441 6:144930071-144930093 ATTTGGGCAGGGTGGGAGCGTGG + Intergenic
1016526676 6:145009681-145009703 AGTTGGGTAGGGAGGAAGGGAGG + Intergenic
1016532557 6:145074975-145074997 ATTGGGGAAGGGAGGGAGGAAGG + Intergenic
1017802024 6:157905539-157905561 ATTTGGCTATGGGGAGGGGGTGG - Intronic
1019772935 7:2895051-2895073 ATCTGGGTCTGCAGGGAGGAGGG + Intergenic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020173839 7:5866487-5866509 AGTTAGGAAAGGAGGGAGGGAGG + Intergenic
1020550069 7:9592945-9592967 ACTTGAGTGTGGAGGGTGGGAGG + Intergenic
1020604550 7:10320031-10320053 ATGAGGAAATGGAGGGAGGGAGG - Intergenic
1021316743 7:19157297-19157319 ATTTGGGAAGGGTGGGAGGTGGG - Intergenic
1021461533 7:20892595-20892617 ATTGAGGTATTGGGGGAGGGTGG + Intergenic
1021564301 7:22001493-22001515 ATTTGTCCATTGAGGGAGGGAGG + Intergenic
1021747932 7:23762231-23762253 ATCTCGGGGTGGAGGGAGGGGGG - Intronic
1021773477 7:24028387-24028409 ACTTTGGAATGGAGTGAGGGAGG + Intergenic
1022109236 7:27218185-27218207 AGGTAGGTAAGGAGGGAGGGAGG - Intergenic
1022698929 7:32738441-32738463 ATTTGGACAGGGAGAGAGGGAGG + Intergenic
1023738582 7:43256993-43257015 ATTTGGGAACGGAGAGAGAGTGG - Intronic
1023785267 7:43701252-43701274 ATTTGAGGATGGAGAGTGGGAGG - Intronic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1024166016 7:46731095-46731117 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1024342447 7:48281218-48281240 ATATGATTATGCAGGGAGGGAGG + Intronic
1024843352 7:53613749-53613771 ATGGGGGTGTGGAGGGAGTGAGG + Intergenic
1025964033 7:66251422-66251444 ATTTTGGGATGGGGAGAGGGAGG - Intronic
1026213190 7:68324871-68324893 ATCTGTATATGGAGGGAGGGAGG - Intergenic
1026833287 7:73622988-73623010 ATTTGGGGAGGGAGGGAGAAGGG + Intronic
1027159229 7:75790250-75790272 AAAGAGGTATGGAGGGAGGGAGG - Intergenic
1027240859 7:76327671-76327693 ATTTGGGGGGGGAGGGGGGGGGG - Exonic
1027461146 7:78455152-78455174 ATATGTGTGTGGAGGGAGGGTGG + Intronic
1027935593 7:84598041-84598063 GTTGAGGTAGGGAGGGAGGGAGG + Intergenic
1028163081 7:87507978-87508000 ATTAGTGTAGGGAGGGAAGGGGG + Intronic
1028243786 7:88451934-88451956 TCTTGGGTATGAGGGGAGGGAGG - Intergenic
1028374197 7:90129036-90129058 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
1028948122 7:96603734-96603756 AGGTGGGGTTGGAGGGAGGGAGG - Intronic
1029359103 7:100075353-100075375 ATTTGGGAAGGGAGGAAGGGAGG + Intronic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1030105238 7:105981773-105981795 ATTTGGGTGGGGGTGGAGGGTGG - Intronic
1030377801 7:108773672-108773694 AGTTGGGAAGGGAAGGAGGGAGG - Intergenic
1031290745 7:119930368-119930390 ATTTGGGGGTGGAGGGTGAGAGG + Intergenic
1031478801 7:122253575-122253597 AATTGGGGGTGGAGGAAGGGAGG + Intergenic
1032339110 7:131054516-131054538 ATTTAGGAAGGGAGGGAGGAGGG + Intergenic
1033095969 7:138431189-138431211 ATTTGGCGATGGCGGGCGGGGGG - Intergenic
1033485169 7:141781836-141781858 TTTTAGGTAAGTAGGGAGGGAGG - Intronic
1033620261 7:143056131-143056153 ACTTTAGGATGGAGGGAGGGAGG + Intergenic
1033931698 7:146531215-146531237 ACTTGAGGATGGAGGGAGGGAGG + Intronic
1034078558 7:148256188-148256210 TTTTGGTGATGGATGGAGGGTGG - Intronic
1034430989 7:151041070-151041092 AATTGGGTTGAGAGGGAGGGAGG - Intronic
1034465154 7:151223648-151223670 ATGGGGGTAGGGAAGGAGGGAGG + Intronic
1035017483 7:155779214-155779236 ATTTGGAGTGGGAGGGAGGGGGG + Exonic
1037062538 8:14532702-14532724 CTTTGTGTGTGGGGGGAGGGCGG + Intronic
1037114366 8:15206022-15206044 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1037225999 8:16590689-16590711 ATTGGAGGATGGAGGGTGGGAGG + Intergenic
1037844621 8:22272264-22272286 ATTTTGGTATCCATGGAGGGAGG + Intergenic
1038394439 8:27236732-27236754 ACTGGGGTTTGGGGGGAGGGGGG - Exonic
1039385774 8:37134347-37134369 ATTTGGTTCTGGTGGGAGGGTGG - Intergenic
1039457468 8:37717046-37717068 ATTTGTGTGTGGGGGGCGGGGGG + Intergenic
1039751626 8:40483929-40483951 AACAGAGTATGGAGGGAGGGAGG + Intergenic
1039774353 8:40720865-40720887 ATCTGAGTAAGGTGGGAGGGAGG + Intronic
1039836053 8:41257065-41257087 ACTTGGGAATGGATTGAGGGTGG - Intergenic
1040355581 8:46614923-46614945 ATTTGGGGATGGAGAGAGTGGGG - Intergenic
1040895628 8:52365687-52365709 TTTTGGGTTTGGGGGGTGGGGGG + Intronic
1041017604 8:53607487-53607509 ACTTGAGTAGGGAGGGTGGGAGG + Intergenic
1041053714 8:53961384-53961406 CTTGGGGTATGGAGGCAGTGGGG - Intergenic
1041684179 8:60627504-60627526 ATCTGGGTGGGGAAGGAGGGAGG - Intergenic
1042040347 8:64582127-64582149 TTTGGGGTGGGGAGGGAGGGAGG + Exonic
1042236679 8:66620124-66620146 ACATGGTTATGGAGGGAGGGAGG + Intergenic
1042735514 8:71983629-71983651 AATTGGGGGTGGGGGGAGGGCGG - Intronic
1043290609 8:78595579-78595601 ATTTGAGGATGGAAGGTGGGAGG - Intronic
1043310132 8:78848691-78848713 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
1043878230 8:85510665-85510687 AATTGGGTGTGCAGGGAGGAAGG - Intergenic
1044185589 8:89247042-89247064 TTTTGTGTATGGTGGGAGGTAGG + Intergenic
1044824388 8:96182573-96182595 CCCTGGGTTTGGAGGGAGGGTGG - Intergenic
1045014730 8:97990840-97990862 ATTTGGGACTGGAGAGAGTGGGG + Intronic
1045110265 8:98933794-98933816 ACATAGGTATGGAAGGAGGGTGG - Intronic
1045340576 8:101250946-101250968 ATTGAGGGAGGGAGGGAGGGAGG - Intergenic
1045909239 8:107386237-107386259 ATTTGAGGATGGAGGGTAGGAGG + Intronic
1046018399 8:108634234-108634256 TTTTGGGGATGGAGGTGGGGAGG - Intronic
1046066808 8:109207137-109207159 AGTAGGGGATGGAGGGAGGAGGG + Intergenic
1046072031 8:109267271-109267293 ACTTGAGGGTGGAGGGAGGGAGG - Intronic
1046408942 8:113813737-113813759 ATTAGAGAAGGGAGGGAGGGAGG - Intergenic
1046940327 8:119924885-119924907 ACTTGAGTGTGGAGGGTGGGAGG - Intronic
1047018802 8:120752817-120752839 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1047580409 8:126208251-126208273 ATTTGAGGATGGAGGGTGGGAGG - Intergenic
1047791849 8:128211320-128211342 ATTTGAATATGCAGAGAGGGTGG + Intergenic
1048403335 8:134093262-134093284 ATTTGGTTATTGAGGGAATGGGG + Intergenic
1049614726 8:143571119-143571141 ATTTGGGGATGGGGGGAGATGGG - Intronic
1049773013 8:144392424-144392446 GTCTGGGGAGGGAGGGAGGGAGG - Exonic
1050208299 9:3223064-3223086 ATTGGGGTAAGGGGGGTGGGGGG - Exonic
1050614764 9:7390422-7390444 ATTTGGGTCTGGATGCAGGATGG + Intergenic
1050776177 9:9263796-9263818 ACTTGAGTAGGGAGGGTGGGAGG + Intronic
1050969084 9:11846318-11846340 AGATGGGGAAGGAGGGAGGGAGG - Intergenic
1051125866 9:13805088-13805110 AGGAGGGTATGGAGGCAGGGAGG - Intergenic
1051145138 9:14019362-14019384 ACTTGAGGGTGGAGGGAGGGAGG - Intergenic
1051356008 9:16240232-16240254 TTTTGGGTATTCAGGGATGGGGG - Intronic
1051428993 9:16962925-16962947 ATTGGAGTGTGGAGGGTGGGAGG - Intergenic
1051627434 9:19111652-19111674 ATTTTGGGGTGGAGGGAGTGGGG + Intronic
1051664727 9:19457889-19457911 ATTTTGGTATGGGGGTTGGGGGG - Intergenic
1052454082 9:28671628-28671650 ATTTGAGAGTGGAGGGTGGGAGG + Intergenic
1053321701 9:37104576-37104598 GTTGGGGAATGGAGGGAGAGAGG - Intergenic
1053562321 9:39209606-39209628 AGTGGGGGAGGGAGGGAGGGAGG - Intronic
1053828126 9:42047594-42047616 AGTGGGGGAGGGAGGGAGGGAGG - Intronic
1054602433 9:67139856-67139878 AGTGGGGGAGGGAGGGAGGGAGG + Intergenic
1055218133 9:73892535-73892557 ATATGGGTGGGGACGGAGGGAGG + Intergenic
1056431824 9:86535517-86535539 AGTGAGGGATGGAGGGAGGGAGG - Intergenic
1056454716 9:86748678-86748700 AGTGGGTTATGGAGGGAGTGAGG + Intergenic
1056782780 9:89563805-89563827 ATTTGTGTCTGGTGGGCGGGGGG + Intergenic
1057165468 9:92921758-92921780 ATATAGGAAAGGAGGGAGGGAGG - Intergenic
1058132166 9:101265453-101265475 ATTTAGGAATGCATGGAGGGAGG - Intronic
1058209271 9:102147886-102147908 ATTTTGGGGTGGGGGGAGGGGGG - Intergenic
1058227681 9:102385616-102385638 ATTTTGGGGTGGGGGGAGGGGGG + Intergenic
1058549395 9:106097705-106097727 ATTAGGGGGTGGAGGGTGGGAGG + Intergenic
1058916720 9:109574176-109574198 ATTTGAGAATGGAAGGTGGGAGG + Intergenic
1059062475 9:111047689-111047711 ATTGGAGTGTGGAGGGTGGGAGG + Intergenic
1059608558 9:115864933-115864955 AGTAGGGGAGGGAGGGAGGGAGG + Intergenic
1060859747 9:126944577-126944599 AATTGGGTGGGGAGGGAGGGTGG + Intronic
1061152392 9:128836270-128836292 AATGGGGGGTGGAGGGAGGGAGG - Intronic
1061255638 9:129453311-129453333 AATGGGGGATGGAGGGATGGAGG + Intergenic
1061255825 9:129453830-129453852 ATCAGGGTATGGAAGGATGGGGG + Intergenic
1061296871 9:129681679-129681701 TTTGGGGGGTGGAGGGAGGGCGG - Intronic
1186137024 X:6532789-6532811 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137045 X:6532848-6532870 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137056 X:6532878-6532900 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137068 X:6532911-6532933 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137087 X:6532970-6532992 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137106 X:6533029-6533051 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137118 X:6533062-6533084 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137129 X:6533092-6533114 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137141 X:6533125-6533147 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137152 X:6533155-6533177 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137164 X:6533188-6533210 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137176 X:6533221-6533243 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137187 X:6533251-6533273 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137198 X:6533281-6533303 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137218 X:6533343-6533365 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137240 X:6533405-6533427 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137252 X:6533438-6533460 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137263 X:6533468-6533490 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137275 X:6533501-6533523 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137287 X:6533534-6533556 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186237609 X:7530512-7530534 ATTGGAGGATGGAGGGTGGGAGG + Intergenic
1186265342 X:7826938-7826960 ATTTGAGGAAGGAAGGAGGGAGG - Intergenic
1186267155 X:7844205-7844227 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267177 X:7844267-7844289 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267199 X:7844329-7844351 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267211 X:7844362-7844384 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267222 X:7844392-7844414 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267234 X:7844425-7844447 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267245 X:7844455-7844477 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186297738 X:8169171-8169193 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297750 X:8169204-8169226 GTGTGGGGAGGGAGGGAGGGGGG - Intergenic
1186297764 X:8169237-8169259 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297776 X:8169270-8169292 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297788 X:8169303-8169325 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297800 X:8169336-8169358 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297812 X:8169369-8169391 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297824 X:8169402-8169424 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297836 X:8169435-8169457 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297858 X:8169497-8169519 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297870 X:8169530-8169552 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297882 X:8169563-8169585 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297904 X:8169625-8169647 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297926 X:8169687-8169709 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297940 X:8169724-8169746 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297952 X:8169757-8169779 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297964 X:8169790-8169812 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297978 X:8169827-8169849 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324882 X:8466630-8466652 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324955 X:8466838-8466860 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324967 X:8466871-8466893 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324978 X:8466901-8466923 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324989 X:8466931-8466953 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325001 X:8466964-8466986 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325014 X:8466997-8467019 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325036 X:8467059-8467081 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325117 X:8467296-8467318 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186471285 X:9824063-9824085 ATTTGGGTATGAAGTGAATGAGG + Intronic
1186500200 X:10044872-10044894 ATGGGGGGACGGAGGGAGGGAGG - Intronic
1186850916 X:13579242-13579264 ATTTGAGAGTGGAGGGTGGGAGG - Intronic
1187018544 X:15355185-15355207 AATTGAGTATGGATGGCGGGGGG + Exonic
1187755868 X:22525542-22525564 ACTTGAGAGTGGAGGGAGGGAGG + Intergenic
1188093127 X:25988424-25988446 GTTTTGGGATGGGGGGAGGGGGG - Intergenic
1188228014 X:27625854-27625876 ATTTGTGAGTGGAGGGTGGGAGG + Intronic
1188259146 X:28001911-28001933 ACTTGAGGGTGGAGGGAGGGAGG - Intergenic
1188403648 X:29779441-29779463 ATTTGAGAGGGGAGGGAGGGAGG + Intronic
1188576283 X:31654754-31654776 ATTAGAGTGTGGAGGGTGGGAGG + Intronic
1188598234 X:31927564-31927586 TTTTATGTATGGAGGGAAGGTGG - Intronic
1188819070 X:34751383-34751405 ATTTGAAGATGGAGGGTGGGAGG - Intergenic
1189166859 X:38868939-38868961 ATCTTAGTATGGAGGGAGGGTGG + Intergenic
1189219326 X:39357596-39357618 CTTTGGGCATGGAGGGATTGGGG + Intergenic
1189500300 X:41550218-41550240 AGATGGGGGTGGAGGGAGGGAGG - Intronic
1189748399 X:44193801-44193823 ATTTAGGGAAGGAGGGTGGGAGG + Intronic
1189842641 X:45097204-45097226 ATTGGAGTATGGAGGGTGGGAGG + Intronic
1189852639 X:45192584-45192606 GGTTGGGTATGGAGGTAGAGTGG - Intronic
1190102742 X:47534752-47534774 GTTAGGGGCTGGAGGGAGGGAGG + Intergenic
1190109180 X:47578878-47578900 ATTTGGGAAATGAGGAAGGGGGG - Intronic
1190123047 X:47679306-47679328 AATTGGGTATAGAGGGATGAGGG + Intergenic
1190167930 X:48088558-48088580 ACTTGAGAGTGGAGGGAGGGAGG + Intergenic
1190470239 X:50771193-50771215 CTTTGTGTGTGAAGGGAGGGTGG - Intronic
1190682696 X:52841638-52841660 AGGTAGGTAGGGAGGGAGGGAGG + Intergenic
1190880649 X:54490178-54490200 ATTTGAGGGTGGAGGGAGGGAGG + Intronic
1191214941 X:57924102-57924124 ATTGGGGAATGGAGGGAGTATGG + Intergenic
1191233246 X:58114086-58114108 GTTGTGGGATGGAGGGAGGGGGG + Intergenic
1191810613 X:65183407-65183429 ATTTGAGGTTGGAGGGTGGGAGG + Intergenic
1191870431 X:65740739-65740761 ATTTGGGTATTGAAGCAGGGAGG - Exonic
1192095526 X:68206806-68206828 AGGTGGCTATGGAAGGAGGGCGG - Intronic
1192393260 X:70753190-70753212 ATTTGGGTGGGGGGGGTGGGCGG + Intronic
1192632658 X:72789306-72789328 ATCTAGGGAGGGAGGGAGGGAGG + Intronic
1192639744 X:72850445-72850467 GTGTGTGTATGGGGGGAGGGGGG - Intergenic
1192641967 X:72870360-72870382 GTGTGTGTATGGGGGGAGGGGGG + Intergenic
1192649051 X:72931495-72931517 ATCTAGGGAGGGAGGGAGGGAGG - Intronic
1192722163 X:73710544-73710566 ACTTGAGTGTGGAGGGTGGGAGG + Intergenic
1192831846 X:74758555-74758577 ACTTGAGGGTGGAGGGAGGGAGG - Intronic
1193472964 X:81928815-81928837 ATTTGAGGGTGGAGGGTGGGAGG + Intergenic
1193512773 X:82426168-82426190 ACTTGAGAGTGGAGGGAGGGAGG - Intergenic
1193570440 X:83134959-83134981 ACTTGAGTGTGGAGGGAGGGAGG + Intergenic
1193998987 X:88403500-88403522 ACTTGGGTGTGGAGGGTGGGAGG - Intergenic
1194203322 X:90981000-90981022 ATTTGTGTATAGAGTGAGGAGGG + Intergenic
1194260959 X:91695145-91695167 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
1194674120 X:96773241-96773263 ATTTGGGGAGGGCGGGAGGGGGG - Intronic
1195148349 X:102041186-102041208 GTTGGGGTGTGGGGGGAGGGGGG + Intergenic
1195610160 X:106857560-106857582 ACATGAGTATGGAGGGTGGGAGG - Intronic
1195792822 X:108607482-108607504 CTTGGGGTATGGGGGGAGGGTGG - Intronic
1196140981 X:112263050-112263072 TTTTGGGGTTGGGGGGAGGGGGG + Intergenic
1196410279 X:115411285-115411307 TTGTGGTTAGGGAGGGAGGGAGG + Intergenic
1196556341 X:117089008-117089030 AGTTGCTAATGGAGGGAGGGGGG + Intergenic
1196588131 X:117454142-117454164 ATGGGGGGATAGAGGGAGGGAGG - Intergenic
1196819791 X:119693301-119693323 AGTAGGGTATGGAGAGGGGGCGG + Exonic
1197732845 X:129826760-129826782 ATTTGGGGGTGGGGTGAGGGTGG - Intronic
1197753160 X:129979663-129979685 ATCTGGGGATGGAGGCGGGGGGG - Intergenic
1198573071 X:137978959-137978981 ATTTGGGAATGGTGAGAGTGGGG + Intergenic
1198730472 X:139722512-139722534 ATTTGGGAATGGAGAAAGGAAGG + Intergenic
1198837717 X:140821829-140821851 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1199086410 X:143634527-143634549 CTTGGGGTATGGTGGGGGGGGGG + Intronic
1199473400 X:148220038-148220060 CTTTGGGAATGGGGGTAGGGAGG - Intergenic
1200054769 X:153454507-153454529 AGCTGGGGAGGGAGGGAGGGAGG + Exonic
1200082597 X:153585890-153585912 AAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1200579610 Y:4933947-4933969 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
1201144719 Y:11057975-11057997 ATGAGTGGATGGAGGGAGGGAGG + Intergenic
1201227328 Y:11830960-11830982 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic
1201691760 Y:16774963-16774985 ATGGGTGTAGGGAGGGAGGGAGG - Intergenic
1201889399 Y:18925356-18925378 ATTTGAGGGTGGAGGAAGGGAGG + Intergenic