ID: 944743619

View in Genome Browser
Species Human (GRCh38)
Location 2:202635186-202635208
Sequence GCGCCTCACCCGCTGGGACA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944743619_944743631 10 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743631 2:202635219-202635241 CCACGCCGGCCGGCTCCCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 68
944743619_944743625 0 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743625 2:202635209-202635231 AATGGGTCCCCCACGCCGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 46
944743619_944743633 12 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743633 2:202635221-202635243 ACGCCGGCCGGCTCCCTTGGGGG 0: 1
1: 0
2: 0
3: 0
4: 39
944743619_944743641 29 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743641 2:202635238-202635260 TGGGGGTGGTGCGGTGGCCACGG 0: 1
1: 0
2: 12
3: 53
4: 640
944743619_944743638 23 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743638 2:202635232-202635254 CTCCCTTGGGGGTGGTGCGGTGG 0: 1
1: 0
2: 1
3: 29
4: 268
944743619_944743624 -4 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743624 2:202635205-202635227 GCGCAATGGGTCCCCCACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 45
944743619_944743629 9 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743629 2:202635218-202635240 CCCACGCCGGCCGGCTCCCTTGG 0: 1
1: 0
2: 1
3: 11
4: 160
944743619_944743632 11 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743632 2:202635220-202635242 CACGCCGGCCGGCTCCCTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 72
944743619_944743635 15 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743635 2:202635224-202635246 CCGGCCGGCTCCCTTGGGGGTGG 0: 1
1: 0
2: 1
3: 18
4: 123
944743619_944743637 20 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743637 2:202635229-202635251 CGGCTCCCTTGGGGGTGGTGCGG 0: 1
1: 0
2: 0
3: 21
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944743619 Original CRISPR GCGCCTCACCCGCTGGGACA TGG (reversed) Exonic