ID: 944743620

View in Genome Browser
Species Human (GRCh38)
Location 2:202635191-202635213
Sequence TCCCAGCGGGTGAGGCGCAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 166}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944743612_944743620 6 Left 944743612 2:202635162-202635184 CCCAGTCACCGGGGAGGGGGGGG 0: 1
1: 0
2: 1
3: 25
4: 366
Right 944743620 2:202635191-202635213 TCCCAGCGGGTGAGGCGCAATGG 0: 1
1: 0
2: 0
3: 11
4: 166
944743605_944743620 14 Left 944743605 2:202635154-202635176 CCGTCTCGCCCAGTCACCGGGGA 0: 1
1: 0
2: 0
3: 4
4: 97
Right 944743620 2:202635191-202635213 TCCCAGCGGGTGAGGCGCAATGG 0: 1
1: 0
2: 0
3: 11
4: 166
944743598_944743620 18 Left 944743598 2:202635150-202635172 CCCCCCGTCTCGCCCAGTCACCG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 944743620 2:202635191-202635213 TCCCAGCGGGTGAGGCGCAATGG 0: 1
1: 0
2: 0
3: 11
4: 166
944743599_944743620 17 Left 944743599 2:202635151-202635173 CCCCCGTCTCGCCCAGTCACCGG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 944743620 2:202635191-202635213 TCCCAGCGGGTGAGGCGCAATGG 0: 1
1: 0
2: 0
3: 11
4: 166
944743615_944743620 -2 Left 944743615 2:202635170-202635192 CCGGGGAGGGGGGGGACCATGTC 0: 1
1: 0
2: 1
3: 14
4: 223
Right 944743620 2:202635191-202635213 TCCCAGCGGGTGAGGCGCAATGG 0: 1
1: 0
2: 0
3: 11
4: 166
944743603_944743620 15 Left 944743603 2:202635153-202635175 CCCGTCTCGCCCAGTCACCGGGG 0: 1
1: 0
2: 0
3: 11
4: 91
Right 944743620 2:202635191-202635213 TCCCAGCGGGTGAGGCGCAATGG 0: 1
1: 0
2: 0
3: 11
4: 166
944743614_944743620 5 Left 944743614 2:202635163-202635185 CCAGTCACCGGGGAGGGGGGGGA 0: 1
1: 0
2: 1
3: 22
4: 267
Right 944743620 2:202635191-202635213 TCCCAGCGGGTGAGGCGCAATGG 0: 1
1: 0
2: 0
3: 11
4: 166
944743601_944743620 16 Left 944743601 2:202635152-202635174 CCCCGTCTCGCCCAGTCACCGGG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 944743620 2:202635191-202635213 TCCCAGCGGGTGAGGCGCAATGG 0: 1
1: 0
2: 0
3: 11
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944743620 Original CRISPR TCCCAGCGGGTGAGGCGCAA TGG Exonic
900475426 1:2874232-2874254 TGCCAGAGGGTGTGGGGCAAAGG - Intergenic
900609627 1:3539084-3539106 TCCCAGGGGGTGAGGGGTAGAGG + Intronic
900663237 1:3796473-3796495 TGCCAGCAGCTGAGGCGCCATGG - Exonic
902810181 1:18883572-18883594 TCCCAGGGGCTGAGGGGGAAAGG + Intronic
902845496 1:19107045-19107067 CCCCAGGGGGTGATGTGCAAAGG + Intronic
902906734 1:19563835-19563857 TCCCAGGGGCAGAAGCGCAAGGG + Intergenic
903169140 1:21541373-21541395 GCCCAGCTGGTGAGGGGCAGAGG + Intronic
906893753 1:49748157-49748179 TGTCAGGGGGTGGGGCGCAAGGG - Intronic
914747781 1:150512231-150512253 TCCCAGCCCGAGAGGCCCAAAGG - Intronic
916591393 1:166194390-166194412 TGTCAGCGGGTGGGGGGCAAGGG + Intergenic
919746867 1:201014291-201014313 ACCCAGCGGGTCAGGGGCAGGGG - Intronic
920372083 1:205485465-205485487 TGCCAGTGGGAGAGGCGAAAGGG + Intergenic
920512067 1:206558839-206558861 TTCCAGAGGGTGAGGGGCAAAGG + Intronic
923130584 1:231071397-231071419 TCCCAGTGGGTTAGGAGCATGGG + Intergenic
924017235 1:239740615-239740637 TGTCAGGGGGTGAGGGGCAAGGG - Intronic
1064729881 10:18319442-18319464 TCTCAGGGGGTGGGGGGCAAGGG + Intronic
1068173013 10:53421051-53421073 TGTCAGTGGGTGAGGGGCAAGGG - Intergenic
1068347069 10:55794997-55795019 TGCCAGAGGGTGTGGGGCAAGGG + Intergenic
1069627159 10:69875432-69875454 TCCCAGCAGGTGACTGGCAAAGG - Intronic
1072045441 10:91650131-91650153 TTCCAGGGGGTGGGGGGCAAGGG + Intergenic
1075290110 10:121222061-121222083 TTCCAGTGGGGGAGGGGCAAAGG + Intergenic
1075589852 10:123683615-123683637 TCCCCATGGGTGAGGAGCAAGGG + Intronic
1076633933 10:131870517-131870539 TCCCAGCAGGTGAGGGTGAAGGG - Intergenic
1077285518 11:1763668-1763690 TTCCAGCGCGGGGGGCGCAAGGG + Intronic
1077877278 11:6319404-6319426 GCCCAGCGGCTGCGGCGCACCGG - Exonic
1081131617 11:39388153-39388175 TCCCAGAGGTTGAGGCGGCAGGG - Intergenic
1082629409 11:55524091-55524113 TGTCAGGGGGTGAGGAGCAATGG - Intergenic
1085274317 11:75288544-75288566 TCTCAGCGAGTGAGCAGCAAGGG - Intronic
1090172733 11:124618886-124618908 TCCCAGCGGCCGAGGTGGAAGGG - Intronic
1101691378 12:107085655-107085677 TGCCAGGGGTTGAGGGGCAAGGG + Intronic
1105517585 13:21104356-21104378 TCCCAGCCCGCGAGGCGCCAGGG - Intergenic
1108259782 13:48645057-48645079 TCCATGCTGGTGAGGTGCAATGG - Intergenic
1111999718 13:95198953-95198975 TGTCAGAGGGTGAGGGGCAAGGG + Intronic
1113435104 13:110285322-110285344 TCCCAGTGAGTGAGGCCCACAGG - Intronic
1119878071 14:78077200-78077222 TCCCATGGGGTGAGGGGAAAAGG + Intergenic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1121624019 14:95371577-95371599 TCCCTGCGGCTGAGGAGAAACGG - Intergenic
1122826647 14:104373972-104373994 TCCCACCGGGTGAAGGTCAAGGG + Intergenic
1122838580 14:104443414-104443436 TTCCAGCAGGTGAGGGGCAGGGG - Intergenic
1122979449 14:105185088-105185110 TCCCACCGGGTGAAGGTCAAGGG + Intergenic
1128037930 15:64542987-64543009 TGTCAGCGGGTGGGGGGCAAGGG + Intronic
1128712148 15:69879969-69879991 TACCAGCGGGTGAGGGGATAGGG - Intergenic
1129200134 15:73993772-73993794 TCCCAGCTGGTAAGGGGAAAGGG - Intronic
1134521672 16:14921698-14921720 TCCCACTGGGAGAGGGGCAAGGG - Intronic
1134709343 16:16320349-16320371 TCCCACTGGGAGAGGGGCAAAGG - Intergenic
1134716554 16:16360378-16360400 TCCCACTGGGAGAGGGGCAAGGG - Intergenic
1134950260 16:18348296-18348318 TCCCACTGGGAGAGGGGCAAGGG + Intergenic
1134958196 16:18391781-18391803 TCCCACTGGGAGAGGGGCAAGGG + Intergenic
1135974797 16:27101199-27101221 TTTCAGCGGGTGGGGGGCAAGGG + Intergenic
1137310416 16:47251357-47251379 TCCCAGCTTGTGAGCCCCAAAGG + Intronic
1138294370 16:55873907-55873929 TCCCAGCGGGGGAGCAGCAAAGG + Exonic
1139709289 16:68763537-68763559 TCCCAGAGTGAGAGGGGCAAGGG + Intronic
1141932822 16:87217146-87217168 TGCCAGGGGGTGAGGCCCACGGG + Intronic
1143304391 17:5934293-5934315 TGCCAGTGGGTGGGGGGCAAGGG - Intronic
1143810612 17:9468632-9468654 TCCCAGCAGCTGAGGCAGAAAGG - Intronic
1144808648 17:17984527-17984549 TCACATCTGGTGAGGGGCAATGG + Intronic
1146364075 17:32205163-32205185 TGTCAGGGGGTGAGGGGCAAGGG - Intronic
1147420578 17:40320370-40320392 GCCCAGCGGGGGAGGCACATGGG - Intronic
1151962814 17:77416214-77416236 TCCCAGCTGGAGAGGGTCAAGGG + Intronic
1152862322 17:82703519-82703541 TCCCAGCGGGTGAGGGCCCCGGG + Intergenic
1160942686 19:1627735-1627757 GCCCAGGGGGTGGGGCGGAAAGG + Intronic
1160942707 19:1627803-1627825 TCACAGGGGGTGAGGCGGGAAGG + Intronic
1160942717 19:1627838-1627860 TCACAGGGGGTGAGGCGGGAAGG + Intronic
1160942727 19:1627873-1627895 TCACAGGGGGTGAGGCGGGAAGG + Intronic
1160942737 19:1627908-1627930 TCACAGGGGGTGAGGCGGGAAGG + Intronic
1160942765 19:1628011-1628033 TCACAGGGGGTGAGGCGGGAAGG + Intronic
1160942775 19:1628046-1628068 TCACAGGGGGTGAGGCGGGAAGG + Intronic
1160942822 19:1628216-1628238 TCACAGGGGGTGAGGCGGGAAGG + Intronic
1160942860 19:1628353-1628375 TCACAGGGGGTGAGGCGGGAAGG + Intronic
1160942878 19:1628421-1628443 TCACAGGGGGTGAGGCGGAAAGG + Intronic
1160942897 19:1628491-1628513 TCACAGGGGGTGAGGCGGGAAGG + Intronic
1160942928 19:1628594-1628616 TCACAGGGGGTGAGGCGGGAAGG + Intronic
1160942946 19:1628662-1628684 TCACAGGGGGTGAGGCGGAAAGG + Intronic
1160942965 19:1628732-1628754 TCACAGGGGGTGAGGCGGGAAGG + Intronic
1160943029 19:1628967-1628989 TCACAGGGGGTGAGGCGGGAAGG + Intronic
1161196028 19:2987246-2987268 TCCCTGAGGGTGAGGGGGAAGGG + Intronic
1163375740 19:16929165-16929187 TCAAAGCGGGTGAGGCGCAGTGG + Exonic
1165511426 19:36268737-36268759 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165511974 19:36271260-36271282 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165513073 19:36276302-36276324 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165513629 19:36278857-36278879 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165514179 19:36281391-36281413 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165514731 19:36283928-36283950 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165515283 19:36286461-36286483 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165515833 19:36288997-36289019 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165516384 19:36291534-36291556 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165516936 19:36294060-36294082 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165517489 19:36296583-36296605 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165518041 19:36299118-36299140 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165518592 19:36301653-36301675 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165519141 19:36304185-36304207 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165519691 19:36306700-36306722 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1165520240 19:36309228-36309250 TCCCAGCGGGTGATCGGGAATGG - Intergenic
1166198006 19:41219338-41219360 TCCCAGCGGGGGAGGGGGCAGGG - Exonic
1166791032 19:45398465-45398487 TCCCAGCTGGGGAGGTGAAAGGG - Intronic
1167002672 19:46755448-46755470 TGGCAGCGGGTGAGCCGCATGGG - Exonic
1168062829 19:53902996-53903018 TCCCAGGGGGTGAGGCCAGAGGG + Intronic
1168701030 19:58439722-58439744 TCCCAGCGGGTGAGGGCCTGGGG + Intronic
926214038 2:10892759-10892781 ACCCAGCGTGTGAGGAGCCATGG + Intergenic
926302071 2:11611708-11611730 TCCCAGATGGTGGGGGGCAATGG + Intronic
929464102 2:42129325-42129347 TACCAGAGGGTGAGGGGCCAGGG - Intergenic
934945600 2:98539046-98539068 TCGCAGCAGGTGGGGAGCAAAGG - Intronic
935570843 2:104659149-104659171 TGCCACCGAGTGGGGCGCAAGGG - Intergenic
937278487 2:120701713-120701735 TCCCAGCGGGTAAGACACACTGG + Intergenic
940077496 2:149759398-149759420 TGCCAGCGGGTGAGGGGCTAGGG - Intergenic
943098784 2:183461507-183461529 TTTCAGCGGGTGAGGGGCTAGGG - Intergenic
944502776 2:200378974-200378996 TCCCAGAGAGTCAGGCGCAAAGG - Intronic
944743620 2:202635191-202635213 TCCCAGCGGGTGAGGCGCAATGG + Exonic
1169067780 20:2704189-2704211 TCCCAGGGGGTGGGGCTCACTGG + Intronic
1169289706 20:4338669-4338691 TGTCAGGGGGTGAGGGGCAAGGG - Intergenic
1169983863 20:11420412-11420434 TGTCAGGGGGTGAGGGGCAAAGG - Intergenic
1170608962 20:17895782-17895804 TGCCAGCGGGGGCGGCGGAAAGG - Intergenic
1170731611 20:18980876-18980898 TGTCAGAGGGTGAGGGGCAAGGG - Intergenic
1171155017 20:22864115-22864137 TCCCAGTGGGTGGGGGGCAGTGG - Intergenic
1171366836 20:24630746-24630768 TCCCAGCAGGGGTGGCCCAAGGG - Intronic
1172633298 20:36393207-36393229 TCCCAGGGGATGAGGTGCATTGG + Intronic
1173650715 20:44662416-44662438 TCCCAGTGGGGGAGGGGCACAGG + Intergenic
1173993353 20:47319714-47319736 TCCCAGCTGGGGAGGAGAAAGGG - Intronic
1175272078 20:57741523-57741545 ACCCAGCGGGTAAGGTACAATGG - Intergenic
1175941901 20:62541255-62541277 TCCCAGCAGAGGAGGCCCAATGG - Intergenic
1183186240 22:36293206-36293228 TCCCAGGGGGAGAGCAGCAATGG + Intronic
1184277070 22:43414971-43414993 TCCTAGAGGGTGAGGCGCCCAGG - Intronic
950634877 3:14307672-14307694 TCCCAGTGGGAGAGGCGCGGCGG - Intergenic
950984879 3:17351574-17351596 TTTCAGCGGGTGGGGAGCAAGGG + Intronic
951027540 3:17845666-17845688 TACCAGGGGGTGAGGATCAATGG + Intronic
958993900 3:100879168-100879190 TACCAGGGGGTGAGGGGCAAGGG - Intronic
959748069 3:109800728-109800750 TGTCAGGGGGTGAGGAGCAAAGG + Intergenic
959832170 3:110876870-110876892 TGTCAGGGGGTGAGGGGCAAGGG - Intergenic
959843424 3:111004583-111004605 TGTCAGCGGGTGAGGGGCAAGGG + Intergenic
965110088 3:164409834-164409856 TGCCAAAGGGTGAGGGGCAAAGG - Intergenic
970001372 4:11368950-11368972 GCCCAGCGGGAGAGCCCCAAGGG - Intergenic
971510854 4:27421623-27421645 TCCAGGGGGGTGAGGAGCAAGGG - Intergenic
977273645 4:94949119-94949141 TCTCAGTGGGTGGGGGGCAAGGG - Intronic
977649596 4:99454418-99454440 TCCCAGCCAGTGAGGAGGAATGG + Intergenic
984619211 4:181933009-181933031 TCCCAGGGGGTTGGGGGCAAGGG + Intergenic
984743893 4:183194725-183194747 TCCAGGCGGGTGAGGTGGAAGGG + Intronic
985941944 5:3143333-3143355 TTCCAGCGGGTGAAGAGAAACGG - Intergenic
986739610 5:10694603-10694625 ACACAGTGGGTGAGGCCCAAGGG - Intronic
987974933 5:25002970-25002992 TATCAGGGGGTGTGGCGCAAGGG - Intergenic
994594153 5:101809119-101809141 TGTCAGGGGGTGAGGGGCAAGGG + Intergenic
994940789 5:106321420-106321442 TCCCAGCAGATGAGGAGGAAGGG + Intergenic
1001416356 5:171547032-171547054 TGTCGGCGGGTGAGGAGCAAGGG - Intergenic
1004809530 6:19244446-19244468 TGTCAGTGGGTGGGGCGCAAGGG + Intergenic
1007585985 6:42989765-42989787 TCCCAGGGGGTGAGGCAGAAGGG + Intronic
1007589728 6:43013884-43013906 TCTGAGCGGGTGAGGCGCGCGGG - Exonic
1007612410 6:43159007-43159029 TCCCAGAGGGTGAGGGGCAGAGG + Intronic
1010476304 6:76293011-76293033 TGCCAGCGGGTGAGAGGCTAGGG - Intergenic
1012801444 6:103834101-103834123 TGCCAGGGGGTGGGGAGCAAGGG + Intergenic
1013792663 6:113855068-113855090 TCCCAGCGTCAGGGGCGCAAGGG - Intergenic
1018966522 6:168494769-168494791 TCCCAGCAGCTGAAGGGCAAGGG + Intronic
1023503086 7:40871684-40871706 TACCAGAGGGTGAGGCTCACTGG - Intergenic
1025015472 7:55435683-55435705 CCCCAGAGGCTGAGGCGCAGGGG + Intergenic
1035219711 7:157399032-157399054 TCTCAGAGGGTGAGGCTGAACGG + Intronic
1042527752 8:69782060-69782082 TGTCAGCGGGTGTGGGGCAAGGG + Intronic
1044125783 8:88456999-88457021 TCCCACCGGGTGAGAAGGAATGG - Intergenic
1048306818 8:133290199-133290221 TCCCACAGGGTGAGGCTGAAGGG + Intronic
1048442825 8:134472441-134472463 TCTCAGAGGGTGAAGCACAAGGG + Intergenic
1049235949 8:141512417-141512439 TCCCAGCCCGGGAGGGGCAAAGG - Intergenic
1049434325 8:142579474-142579496 TCCCAGCAAGTGGGGCTCAAAGG - Intergenic
1050200641 9:3142091-3142113 TCTCAGTGGGTGAGGGGCTAGGG - Intergenic
1050884210 9:10743444-10743466 TGCCGGCGGGTGAGGGGCTAGGG + Intergenic
1050996048 9:12218802-12218824 TGTCAGCGGGTGGGGGGCAAGGG + Intergenic
1053559869 9:39180939-39180961 TCCCAGCTGGTCAGGTGCAGTGG + Intronic
1053823978 9:42001160-42001182 TCCCAGCTGGTCAGGTGCAGTGG + Intronic
1054137247 9:61438016-61438038 TCCCAGCTGGTCAGGTGCAGTGG - Intergenic
1054606595 9:67186203-67186225 TCCCAGCTGGTCAGGTGCAGTGG - Intergenic
1055939256 9:81634227-81634249 TCCCGAAGGGTGAGGCGTAAGGG + Exonic
1059426782 9:114226206-114226228 ACCCAGCATGTGAGGGGCAATGG + Intronic
1060146017 9:121253058-121253080 TCCCACCACGTGAGGCACAATGG - Intronic
1060411496 9:123403270-123403292 TCCCAGCGGGTGTTTCACAAAGG - Intronic
1189727777 X:43985862-43985884 CCCCAGAGGGTGAGGTACAATGG - Intergenic
1191253111 X:58268609-58268631 TCCCACCCGGTGCGGCGCAGGGG + Intergenic
1191830391 X:65408507-65408529 TCCCGAAGGGTGAGGCGTAAGGG - Intronic
1192529529 X:71872849-71872871 TCCCAGTGGGAGAGGCGCCCTGG - Intergenic
1194456217 X:94106908-94106930 TGTCAGGGGGTGAGGGGCAAGGG + Intergenic
1194492143 X:94565177-94565199 TGTCAGGGGGTGAGGGGCAAGGG - Intergenic
1197087175 X:122492619-122492641 TGTCAGGGGGTGGGGCGCAAGGG - Intergenic
1198762135 X:140043319-140043341 TGTCAGGGGGTGAGGGGCAAGGG - Intergenic