ID: 944743621

View in Genome Browser
Species Human (GRCh38)
Location 2:202635192-202635214
Sequence CCCATTGCGCCTCACCCGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 69}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944743621_944743641 23 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743641 2:202635238-202635260 TGGGGGTGGTGCGGTGGCCACGG 0: 1
1: 0
2: 12
3: 53
4: 640
944743621_944743624 -10 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743624 2:202635205-202635227 GCGCAATGGGTCCCCCACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 45
944743621_944743645 30 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743645 2:202635245-202635267 GGTGCGGTGGCCACGGCCGGGGG 0: 1
1: 0
2: 1
3: 15
4: 247
944743621_944743638 17 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743638 2:202635232-202635254 CTCCCTTGGGGGTGGTGCGGTGG 0: 1
1: 0
2: 1
3: 29
4: 268
944743621_944743643 28 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743643 2:202635243-202635265 GTGGTGCGGTGGCCACGGCCGGG 0: 1
1: 0
2: 0
3: 14
4: 187
944743621_944743637 14 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743637 2:202635229-202635251 CGGCTCCCTTGGGGGTGGTGCGG 0: 1
1: 0
2: 0
3: 21
4: 251
944743621_944743631 4 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743631 2:202635219-202635241 CCACGCCGGCCGGCTCCCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 68
944743621_944743632 5 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743632 2:202635220-202635242 CACGCCGGCCGGCTCCCTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 72
944743621_944743629 3 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743629 2:202635218-202635240 CCCACGCCGGCCGGCTCCCTTGG 0: 1
1: 0
2: 1
3: 11
4: 160
944743621_944743625 -6 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743625 2:202635209-202635231 AATGGGTCCCCCACGCCGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 46
944743621_944743644 29 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743644 2:202635244-202635266 TGGTGCGGTGGCCACGGCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 145
944743621_944743642 27 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743642 2:202635242-202635264 GGTGGTGCGGTGGCCACGGCCGG 0: 1
1: 0
2: 1
3: 28
4: 210
944743621_944743633 6 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743633 2:202635221-202635243 ACGCCGGCCGGCTCCCTTGGGGG 0: 1
1: 0
2: 0
3: 0
4: 39
944743621_944743635 9 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743635 2:202635224-202635246 CCGGCCGGCTCCCTTGGGGGTGG 0: 1
1: 0
2: 1
3: 18
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944743621 Original CRISPR CCCATTGCGCCTCACCCGCT GGG (reversed) Exonic