ID: 944743625

View in Genome Browser
Species Human (GRCh38)
Location 2:202635209-202635231
Sequence AATGGGTCCCCCACGCCGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944743614_944743625 23 Left 944743614 2:202635163-202635185 CCAGTCACCGGGGAGGGGGGGGA 0: 1
1: 0
2: 1
3: 22
4: 267
Right 944743625 2:202635209-202635231 AATGGGTCCCCCACGCCGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 46
944743619_944743625 0 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743625 2:202635209-202635231 AATGGGTCCCCCACGCCGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 46
944743612_944743625 24 Left 944743612 2:202635162-202635184 CCCAGTCACCGGGGAGGGGGGGG 0: 1
1: 0
2: 1
3: 25
4: 366
Right 944743625 2:202635209-202635231 AATGGGTCCCCCACGCCGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 46
944743615_944743625 16 Left 944743615 2:202635170-202635192 CCGGGGAGGGGGGGGACCATGTC 0: 1
1: 0
2: 1
3: 14
4: 223
Right 944743625 2:202635209-202635231 AATGGGTCCCCCACGCCGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 46
944743621_944743625 -6 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743625 2:202635209-202635231 AATGGGTCCCCCACGCCGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 46
944743623_944743625 -7 Left 944743623 2:202635193-202635215 CCAGCGGGTGAGGCGCAATGGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 944743625 2:202635209-202635231 AATGGGTCCCCCACGCCGGCCGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944743625 Original CRISPR AATGGGTCCCCCACGCCGGC CGG Exonic