ID: 944743629

View in Genome Browser
Species Human (GRCh38)
Location 2:202635218-202635240
Sequence CCCACGCCGGCCGGCTCCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944743619_944743629 9 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743629 2:202635218-202635240 CCCACGCCGGCCGGCTCCCTTGG 0: 1
1: 0
2: 1
3: 11
4: 160
944743623_944743629 2 Left 944743623 2:202635193-202635215 CCAGCGGGTGAGGCGCAATGGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 944743629 2:202635218-202635240 CCCACGCCGGCCGGCTCCCTTGG 0: 1
1: 0
2: 1
3: 11
4: 160
944743615_944743629 25 Left 944743615 2:202635170-202635192 CCGGGGAGGGGGGGGACCATGTC 0: 1
1: 0
2: 1
3: 14
4: 223
Right 944743629 2:202635218-202635240 CCCACGCCGGCCGGCTCCCTTGG 0: 1
1: 0
2: 1
3: 11
4: 160
944743621_944743629 3 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743629 2:202635218-202635240 CCCACGCCGGCCGGCTCCCTTGG 0: 1
1: 0
2: 1
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944743629 Original CRISPR CCCACGCCGGCCGGCTCCCT TGG Exonic